-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Aldo E. García-Guerrero, et al.,
bioRxiv - Microbiology 2024
Quote:
... Membranes were blocked at room temperature for 1 hour in 5% skim milk/PBS and probed overnight at 4°C with 1:1000 dilutions of rabbit anti-HSP60 (Novus NBP2-12734) and goat anti-GFP (Antibodies.com A121560) antibodies ...
-
No products found
because this supplier's products are not listed.
Tongcui Ma, et al.,
bioRxiv - Microbiology 2023
Quote:
... or conjugated in-house with X8 antibody-labeling kits (Standard BioTools) and stored at 4°C in Antibody Stabilizer (Boca Scientific) supplemented with 0.05% sodium azide ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Serial cross sections (5□µm thick) were immunostained with rabbit anti-mouse LYVE1 (1:100) polyclonal antibody (11-034, AngioBio Co). DAB (3,3′ -Diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Minsuk Kong, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... Increasing ratios (multiplicities of incubation ranging from 20 to 150) of SSHELαHER2 (labeled with AlexaFluor647) were incubated with 5 × 105 cells/ml in siliconized tubes (G-tubes, Bio Plas Inc.) for 1 h at 37 °C with gentle inversion ...
-
No products found
because this supplier's products are not listed.
Jessica B. Blackburn, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 25 μg of SIgA was incubated with 10 μg sputum-derived human neutrophil elastase (1 ug/uL in 0.05 M NaOAc pH 5 containing 0.1 M NaCl, Elastin Products Company, SE563GI) with or without a protease inhibitor (Sigma ...
-
No products found
because this supplier's products are not listed.
Laura Martinez-Ruiz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Tumor pieces were digested using 5–10 mL of a 2.5 mg/mL Collagenase NB4 standard (S1745401 Nordmark Biochemicals, Uetersen, Germany) solution in PBS + 3 mM CaCl2 for 2 hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Elizabeth C. Townsend, et al.,
bioRxiv - Microbiology 2023
Quote:
... the samples were stained with a PNA-FISH-TexasRed-5-conjugated universal bacterial (BacUni) 16s rRNA probe (AdvanDx, Woburn, MA, US), incubated and then counterstained with 3 µM 4′,6-diamidino-2-phenylindole (DAPI ...
-
No products found
because this supplier's products are not listed.
Sayak Mukhopadhyay, et al.,
bioRxiv - Microbiology 2024
Quote:
We washed the cell culture twice in motility buffer (MB) at 1500 g for 5 min in a centrifugation unit (Scilogex SCT412). The supernatant was discarded ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... resuspended proteins were PEGylated for 1 hr at RT to label newly exposed cysteine thiols with the 5 kDa mass tag reagent (mPEG-5k, Badrilla SiteCounter™). Approximately 20 μl of each supernatant was saved as the “total input.” For immunoblot analysis ...
-
No products found
because this supplier's products are not listed.
Devin Rocks, et al.,
bioRxiv - Neuroscience 2023
Quote:
... n=5/sex/group) were rinsed with distilled water and underwent the Golgi-Cox staining procedure (Golgi-Cox OptimStain Kit, Hitobiotec Inc. #HTKNS1125) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
Thomas F. Martinez, et al.,
bioRxiv - Genomics 2019
Quote:
... Fluorescein-labeled reference peptide KVFPC(FITC)ALINK was synthesized by covalently coupling of fluorescein to the cysteine residue with 5-(iodoacetamido)fluorescein (Marker Gene Technologies, M0638) for use in the HLA-binding assay ...
-
No products found
because this supplier's products are not listed.
James M. Fulcher, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50-cm length) were slurry-packed with C2 packing material (5 µm and 3 µm for trap/analytical respectively, 300 Å, Separation Methods Technology). Samples were loaded into a 5 µL loop ...
-
No products found
because this supplier's products are not listed.
Rebecca C.S. Edgar, et al.,
bioRxiv - Microbiology 2023
Quote:
... Venous blood (5 mL) was collected by venipuncture and after removal of host white blood cells using Plasmodipur filters (EuroProxima B.V., The Netherlands), packed infected red blood cells (iRBCs ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Weng Hua Khoo, et al.,
bioRxiv - Immunology 2022
Quote:
... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Jonathan M Budzik, et al.,
bioRxiv - Microbiology 2019
Quote:
Immunostaining for LC3 was performed with blocking and permeabilization buffer (0.3% Triton X-100, 2% bovine serum albumin) and anti-LC3 (clone 2G6, Nanotools #0260-100/LC3-2G6) at a dilution of 1:200 for 3 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Ken Shirato, Jun Takanari, Takako Kizaki,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... the cells were co-treated with the indicated concentrations of ETAS®50 or dextrin and 100 ng/mL of SARS-CoV-2 spike recombinant protein S1 subunit (Arigo Biolaboratories, Hsinchu City, Taiwan) for 1 to 24 h ...
-
No citation found on bioRxiv
-
Cat# CDC10-0325,
10 g, Inquire for price
No citation found on bioRxiv
-
No citation found on bioRxiv
-
Catalog Number: B2011232 (5 mg)
5-Bromo-2’-deoxyuridine (BrdU) is a high quality biomarker...
Cat# B2011232,
USD $495.0
No citation found on bioRxiv
-
Cat# RP-1192,
250 mg; 500 mg; 1 g, Inquire
No citation found on bioRxiv
-
Peptide to TRAP-6 (2-6)
Cat# CCP2948,
1 mg USD $100.0, 5 mg USD $250.0, 10 mg USD $375.0
No citation found on bioRxiv
-
Cat# DIA-0230678,
Inquiry
No citation found on bioRxiv
-
Cat# MEVs-303,
1 vial, USD $528
No citation found on bioRxiv
-
Cat# R1397-5g,
USD $321.26/ea
No citation found on bioRxiv
-
Pure B Powder
Cat# MET-0079,
1 kg, USD $320.0
No citation found on bioRxiv
-
SeedEZ 3D cell culture scaffold for 6 well plates (pack of 6 scaffolds)
Cat# SC-C006-0006,
6 case, $228.00
No citation found on bioRxiv