-
No products found
because this supplier's products are not listed.
Gary Reynolds, et al.,
bioRxiv - Immunology 2020
Quote:
... then resuspended in 200 μl of flow buffer per 106 cells with 3 μM DAPI (Sysmex Partec, 05-5005). Cells were then run through a Fortessa X20 for analysis ...
-
No products found
because this supplier's products are not listed.
Kirit Singh, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Cryopreserved PBMCs from healthy donors and from glioblastoma patients were then thawed into PrimeXV T-cell expansion media (FujiFilm) supplemented with 3% of human platelet lysate (hPL, Compass Biomedical) and pelleted at 300g for 10 min ...
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Scot P. Ouellette, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1mM glucose-6-phosphate (Moltox), and 10nM aTc ...
-
No products found
because this supplier's products are not listed.
J. Ignacio Gutiérrez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 100 uM Gal4–VP16 (Protein One, P1019-02) and 100 uM ATP or AMP-PNP ...
-
No products found
because this supplier's products are not listed.
James M. Fulcher, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 50-cm length) were slurry-packed with C2 packing material (5 µm and 3 µm for trap/analytical respectively, 300 Å, Separation Methods Technology). Samples were loaded into a 5 µL loop ...
-
No products found
because this supplier's products are not listed.
Alyssa R. Phillips, et al.,
bioRxiv - Plant Biology 2023
Quote:
... About 1 mm of the tip (meristem and root cap) was excised and transferred to a tube containing 20 µL of 3% cellulase R-10 (Desert Biologicals, Phoenix, AZ) and 1.25% pectolyase Y-23 (Desert Biologicals ...
-
No products found
because this supplier's products are not listed.
Jiling Feng, Yuexun Tang, Wenwei Fu, Hongxi Xu,
bioRxiv - Cell Biology 2023
Quote:
... RT-PCR was performed with a one-step real time PCR using KAPA SYBR FAST One-Step qRT-PCR Universal (D-MARK Biosciences). Primers were used as previously described [18] ...
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Sarah Howald, et al.,
bioRxiv - Physiology 2021
Quote:
... The magnetic stirrers were connected to one stirrer controller (Rank Brothers Ltd., Cambridge, England). The chamber was closed with a custom-made glass lid with three metal ports ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interleukin 6 (IL6) ELISA Kit (RD-IL6-Mu, Reddot biotech), Mouse Interferon Gamma Induced Protein 10kDa (IP10 ...
-
No products found
because this supplier's products are not listed.
Hao Wang, et al.,
bioRxiv - Biochemistry 2024
Quote:
The gel was prepared with a concentration of 6% (wt/vol) agarose (HydraGene Co. ...
-
No products found
because this supplier's products are not listed.
Hayden A. M. Hatch, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The dSO vial was immediately cleared and placed in one arm of a T-maze (CelExplorer Labs) and an empty vial in another ...
-
No products found
because this supplier's products are not listed.
Xiao Lin, et al.,
bioRxiv - Plant Biology 2020
Quote:
A BAC library of plant GIG362-6 was generated by Bio S&T (Canada). A BAC clone that spans the mapping interval was isolated using molecular markers (Table S2 ...
-
No products found
because this supplier's products are not listed.
Josée Perreault, et al.,
bioRxiv - Immunology 2020
Quote:
... The plates were incubated once again for one hour at RT followed by washing and addition of 100 μl of 3,3’,5,5’-Tetramethylbenzidine (TMB, ESBE Scientific). The colorimetric reaction proceeded for 20 minutes at RT and was stopped by addition of 100 μl of H2SO4 1N (Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Michael A. Sullivan, et al.,
bioRxiv - Neuroscience 2022
Quote:
... iPSCs were cultured with the addition of 10 ng/mL StemBeads fibroblast growth factor 2 (FGF-2) (StemCultures). Upon reaching 80 % confluency ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Abdugaffor Ablazov, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Approximately 20 mg of lyophilized rice samples were extracted twice with 2 mL of ethyl acetate containing 2 ng of D3-zaxinone (customized synthesis; Buchem B.V., Apeldoorn, The Netherlands). After that ...
-
No products found
because this supplier's products are not listed.
Jessica L. Kelliher, et al.,
bioRxiv - Microbiology 2023
Quote:
... Endpoint kinase assays were performed by mixing 3 μg purified PrkA1- 338 with the indicated combinations of ∼3x molar excess of substrate to kinase (6 μg of the generic kinase substrate myelin basic protein [MBP; Novatein Biosciences, Woburn ...
-
No products found
because this supplier's products are not listed.
Yalda Afshar, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Confluent endothelial monolayers were grown on tissue culture treated 6-well plates (Falcon #08-772-1B) in complete MCDB-131 media (VEC Technologies # MCDB131-WOFBS) plus 10% FBS (Omega Scientific #FB-11 ...
-
No products found
because this supplier's products are not listed.
Colin Kremitzki, et al.,
bioRxiv - Genetics 2023
Quote:
Lentiviruses carrying the gRNA libraries were packaged into 8×106 HEK 293T cells/well in a 6-well plate (TPP92006, MIDSCI, Fenton, MO, USA), using the TransIT Lentivirus transfection reagent (MIR 6600 ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
Filipy Borghi, et al.,
bioRxiv - Physiology 2021
Quote:
... 4 °C and analyzed using the commercial ELISA kit (Diagnostics Biochem Canada Inc. - Ref CAN-C-290) at the Laboratory of Stress Studies (LABEEST ...
-
No products found
because this supplier's products are not listed.
Erkko Ylösmäki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... while BCG vaccine AJV (2-8×106 C.F.U/vial) from AJ Vaccines (Copenhagen, Denmark) was a kind gift from Professor Helen McShane (University of Oxford).
-
No products found
because this supplier's products are not listed.
Charlène Iltis, et al.,
bioRxiv - Immunology 2021
Quote:
... membranes were stripped at 4°C in agitation using Antibody stripping buffer 1X for 10 minutes (Gene Bio-Application). Protein bands were quantified using ImageJ software ...
-
No products found
because this supplier's products are not listed.
Yansheng Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 150 mM NaCl and 2 mM TCEP containing 6.5 mg/mL phage Pf1 (ASLA BIOTECH).
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nishith M Shrimali, et al.,
bioRxiv - Pathology 2021
Quote:
... and incubated with collagen (10 µg/ml) or ADP (2 µM, both from the Bio/Data Corporation, USA) 10 minutes ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Dorothee Jakob, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... we applied the spider toxin peptide Grammostola spatulata mechanotoxin 4 (GsMTx4) L-isomer (10 μmol/L, H20 as solvent, CSBio, Menlo Park, CA, USA), a known blocker of cation non-selective SAC ...
-
No products found
because this supplier's products are not listed.
Franz Meitinger, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... AZD1390 (ATMi; 1 μM; Chemgood LLC); Palbociclib (CDK4/6i ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Richard J. R. Kelwick, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
Nanoparticle tracking analysis (NTA): 1 μL A549 EVs (1 mg/ml; #HBM-A549-100/5, HansaBioMed, Tallinn, Estonia) were diluted (1:1000 ...
-
No products found
because this supplier's products are not listed.
Sylvain Perriot, et al.,
bioRxiv - Immunology 2024
Quote:
... -C (1:500, AffinityImmuno, clone W6/32) were incubated in 250ul blocking buffer with neurons overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Ellen Gingrich, Kendra Case, A. Denise R. Garcia,
bioRxiv - Neuroscience 2020
Quote:
... sheep anti-BrdU (1:500, Maine Biotechnology Services), mouse anti-CC1 (1:1k ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1 μl of Taq-plus polymerase (NanoHelix, Korea), and 2.5 μl of 10 μM forward/reverse primer ...
-
No products found
because this supplier's products are not listed.
Chuan Liu, et al.,
bioRxiv - Bioengineering 2024
Quote:
... diluted 1:60 or porcine kidney ECM (Xylyx Bio ...
-
No products found
because this supplier's products are not listed.
Taylor Russo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and rabbit polyclonal anti-glycosyslceramide (Glycobiotech #RAS_0010, 1:3,000). Primary antibody was detected with HRP-linked donkey anti–rabbit IgG (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Amalia J. Napoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Larvae were mounted in 1% High EEO agarose (Crystalgen) molds [37] ...
-
No products found
because this supplier's products are not listed.
Yann-Ru Lou, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 1:1 v/v) and loaded to the silica gel column (100 g, 200-425 mesh, 60 A, Jade Scientific Inc, Westland, MI, USA) packed with ethyl acetate/hexane (200 mL ...
-
No products found
because this supplier's products are not listed.
Sung Hee Ko, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analyzed by electrophoresis with precast 1% agarose gel (Embi Tec) or the Agilent High Sensitivity DNA kit (5067-4626 ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... applying polyclonal anti-human epidermal transglutaminase (TG3) antibody (Zedira; 1/2000), monoclonal anti-TG4 antibody (Covalab ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Yuan-Chen Tsai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... AP-5 (50 μM, almone labs) and tetrodotoxin (1 μM, Affix Scientific). 10 min after establishing the whole-cell mode ...