-
No products found
because this supplier's products are not listed.
Subhrangshu Guhathakurta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... from days 1-6 and 3-μM CHIR99021(Reprocell, 04-0004) from days 3-12 ...
-
No products found
because this supplier's products are not listed.
Helmut Bischof, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Glucose uptake was assessed using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2- NBDG) (Biomol GmbH). Therefore ...
-
No products found
because this supplier's products are not listed.
Manuel Hayn, et al.,
bioRxiv - Microbiology 2020
Quote:
... p62 (1:1,000, GP62-N, ProGen), LC3a/β (1:200 ...
-
No products found
because this supplier's products are not listed.
Joseph Atherton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Single-axis cryo-electron tomography was performed at 3-6 μm defocus with a K2 Summit direct electron detector (Gatan) operating in counting mode (at 5 e-per pixel per second ...
-
No products found
because this supplier's products are not listed.
Melis D. Arslanhan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti Centrin-3 (1:1000, Abnova, H8141-3EG), mouse anti V5 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Monica J. Chau, et al.,
bioRxiv - Neuroscience 2021
Quote:
... B cell lymphoma 6 (BCL-6) (MyBiosource, San Diego, CA), samples were neat ...
-
No products found
because this supplier's products are not listed.
Kathryn V. Svec, Mingu Kang, Alan K. Howe,
bioRxiv - Cell Biology 2023
Quote:
... Acrylamide and N,NI-methylenebisacrylamide were purchased from National Diagnostics. Tetramethylethylenediamine (TEMED) ...
-
No products found
because this supplier's products are not listed.
Burt M Sharp, Qin Jiang, Panjun Kim, Hao Chen,
bioRxiv - Neuroscience 2023
Quote:
... 2-(3-(4-chloro-3-fluorophenyl)-5-ethyl-1H-1,2,4-triazol-1-yl)-N-(3,5-di-chlorobenzyl)acetamide (MR-L2) was from Targetmol Chemicals ...
-
No products found
because this supplier's products are not listed.
Emily Lorenzen, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The carboxylated surface of the magnetic beads was then activated with N-hydroxysuccinimide (Pierce) and 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide (Proteochem). After twenty minutes incubation with the activation solution ...
-
No products found
because this supplier's products are not listed.
Carlos J Nogueras-Ortiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... on the metabolic activity of primary neurons were evaluated using the tetrazolium salt 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Trevigen, Gaithersburg, MD), a colorimetric test based on the enzymatic activity of NADPH-dependent cytoplasmic oxidoreductase enzymes that catalyze the reduction of the membrane permeable MTT into colorimetric formazan products ...
-
No products found
because this supplier's products are not listed.
Cathal Meehan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Recombinant IL-6 with an N-terminal his tag (Fitzgerald, Biosynth Ltd.) was immobilized on His-Pur™ Ni-NTA Resin (ThermoScientific ...
-
Cat# 588703-49-5,
Inquire
Ask
Ana C. Puhl, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
Pyronaridine tetraphosphate [4-[(7-Chloro-2-methoxybenzo[b][1,5]naphthyridin-10-yl)amino]-2,6-bis(1-pyrrolidinylmethyl)phenol phosphate (1:4)] (12) was purchased from BOC Sciences (Shirley NY). The purity of this compound was greater than 95% ...
-
No products found
because this supplier's products are not listed.
Kyung Ku Jang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The permeabilized organoids were washed 3 times with PBS and incubated with mouse anti-SARS-CoV-2 N antibody (1:1,000, ProSci, 10-605) and rabbit anti-ACE2 antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Grant Ashby, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Texas Red-DHPE (1,2-dihexadecanoly-snglvero-3-phosphoethanolamine-[N-(Texas Red sulfonyl)]) was purchased from AAT Bioquest. PEG-biotin (Biotin-PEG SVA ...
-
No products found
because this supplier's products are not listed.
Yuuki Wittmer, et al.,
bioRxiv - Biophysics 2022
Quote:
... ∼6 mL using Millipore Amicon Ultra-15 3 kDa MWCO centrifugal filter and dialyzed (Spectrum Laboratories 1.7 ml/cm standard SpectraPor 1 RC Tubing ...
-
No products found
because this supplier's products are not listed.
AJ Brandner, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... a set of eight monofilaments at logarithmic intervals from 0.008 to 6 grams (0.008, 0.023, 0.07, 0.16, 0.4, 1, 2, and 6 grams; Stoelting, Wood Dale, IL) were applied to the center of the plantar surface of the left hind paw for up to 4 seconds using the up–down method (Chaplan et al. ...
-
No products found
because this supplier's products are not listed.
Gema M. Olivarria, et al.,
bioRxiv - Microbiology 2021
Quote:
... Mac2/ Galactin-3 (1:500, CL8942AP Cedarlane), CD4 (1:200 Abcam) ...
-
No products found
because this supplier's products are not listed.
Peter Njenga Ng’ang’a, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 6 × 104 cells in 1 mL DMEM medium (Pan Biotech) were grown for 48 h before addition of 5.8 nM of toxin ...
-
No products found
because this supplier's products are not listed.
Christian Simonsson, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Groups of animals (n=6-10 animals/group) were fed either chow or HFD (D12492 60 E% fat content; Research Diets, New Brunswick, NJ, USA) for 6-8 weeks ...
-
No products found
because this supplier's products are not listed.
Andrea Mohr, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... multimeric FasL and anti-APO-1-3 from AdipoGen Life Sciences (San Diego ...
-
No products found
because this supplier's products are not listed.
Iris E. Glykofridis, et al.,
bioRxiv - Genetics 2022
Quote:
... Ab #3 (1:1000 in BSA, HPA028760, Atlas antibodies) and Ab #4 (1:1000 in BSA ...
-
No products found
because this supplier's products are not listed.
Lindsay Smith, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... mouse anti-PI(3)P (1:100; Echelon Biosciences Inc.), mouse anti-PI(3,4)P2 (1:100 ...
-
No products found
because this supplier's products are not listed.
Kimberly Prescott, et al.,
bioRxiv - Neuroscience 2023
Quote:
... secondary antibodies (NeuN n/a biotinylated primary; anti-rabbit, 1:500, Vector, BA-1000; anti-rat, 1:500, Boster, BA1058) were incubated for 60 minutes at RT ...
-
No products found
because this supplier's products are not listed.
Rebecca L. Pinals, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Solutions were probe-tip sonicated for 10 minutes in an ice bath (3 mm probe tip set at 50% amplitude, 5-6 W, Cole-Parmer Ultrasonic Processor). Samples were centrifuged to pellet insoluble SWCNT bundles and contaminants (16,100 cfg for 30 minutes) ...
-
No products found
because this supplier's products are not listed.
Erika N. Cline, et al.,
bioRxiv - Biochemistry 2021
Quote:
... SEC or RP columns were interfaced to an LTQ Orbitrap XL/ETD with a custom ESI source and a 50 μm (± 3 μm) ESI tip (New Objective TT360-50-50-N-5). The mass spectrometer was tuned to the [M + 10H]10+ of ubiquitin by direct infusion ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Ai Nguyen, et al.,
bioRxiv - Biophysics 2023
Quote:
... N-arm peptides were purchased from ABI Scientific (Sterling ...
-
No products found
because this supplier's products are not listed.
Céline Petitgas, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The primary antibodies used were mouse monoclonal anti-TH (1:1000, cat. n° 22941, ImmunoStar, Hudson, WI, USA) and mouse monoclonal anti-DA (1:100 ...
-
TeloCol®-6 is 50 mL of 6 mg/ml, type I bovine telocollagen solution for 2D coatings or 3D...
Cat# 5225-1KIT,
50 mL, USD $440.0
Ask
Colin D. Paul, et al.,
bioRxiv - Bioengineering 2019
Quote:
Cytosoft 6-well plates (Advanced BioMatrix, San Diego ...
-
No products found
because this supplier's products are not listed.
Candida Wong, et al.,
bioRxiv - Immunology 2020
Quote:
Flow cytometry data was analysed using the FCS Express 6 Flow Cytometry Software version 6 (De Novo Software). CHO cells were primarily gated by forward scatter height (FSC-H ...
-
No products found
because this supplier's products are not listed.
Antonella Conforti, et al.,
bioRxiv - Immunology 2022
Quote:
... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
No products found
because this supplier's products are not listed.
Tamar Frankovits, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
No products found
because this supplier's products are not listed.
Claudia Matthaeus, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and a secondary Rabbit antibody labelled with 12 nm gold particles (Dianova, 1:30 in 3% BSA/PBS) was applied ...
-
No products found
because this supplier's products are not listed.
Ravikanth Maddipati, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... CSF-1R inhibitor (AdooQ Bioscience, A11959-200) was dissolved in 0.5% hydroxypropyl methyl cellulose and 0.1% Tween and dosed 3 times a week at 160mg/kg by oral gavage ...
-
No products found
because this supplier's products are not listed.
Scarlett J Barker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 6-(Trifluoroacetylamino)-hexyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite was purchased from Glen Research (CAS ...
-
No products found
because this supplier's products are not listed.
Yue Hu, et al.,
bioRxiv - Neuroscience 2024
Quote:
... ISO group (n=6) mice were handled and inhaled 1.5% isoflurane (RWD Life Science, 1903715) at 13:00 on day four in the chamber ...
-
No products found
because this supplier's products are not listed.
Antonella Bordin, et al.,
bioRxiv - Cell Biology 2022
Quote:
... ALIX (1:1000, Biorbyt, Cat. N. orb235075), CD9 (1:500 ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
P. Lejeune, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Jiffypots® with weak or abnormal plantlets were discarded and the others were transplanted into 12-cm square plastic cultivation pots filled with 1.5 L of leaf mould and baked clay (4:1) mixed with 6 gr.L−1 of slow release fertilizer (Osmocote Exact Standard 5-6 M, ICL Specialty Fertilizers). The pots were fitted at the bottom with a 2 x 10 cm felt wick and randomly placed on the deck of the cultivation gutters described above ...
-
No products found
because this supplier's products are not listed.
Steven R. Talbot, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... the cecum was 2/3 ligated (Nylon Monofilament Suture 6/0, Fine Science Tools GmbH, Heidelberg, Germany) distal to the ileocecal valve ...
-
No products found
because this supplier's products are not listed.
Yapeng Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The amounts of IL-6 (LS-F31434-1, LifeSpan BioSciences) and TNFα (LS-F57505-1 ...
-
No products found
because this supplier's products are not listed.
Jun Yao, et al.,
bioRxiv - Genomics 2020
Quote:
Human plasma pooled from healthy individuals was purchased from Innovative Research (Innovative Research, IPLA-N). The plasma was prepared by apheresis into K2-EDTA tubes and was certified by the provider as testing negative for HBV ...
-
No products found
because this supplier's products are not listed.
Anna Zhuravskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3 µM CHIR99021 (Cambridge Bioscience, cat# SM13-1), 0.5 mM L-Glutamine (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Kristen Mehalko, et al.,
bioRxiv - Genetics 2022
Quote:
... The tissue was homogenized using a BeadBug 6 microtube homogenizer for 3 rounds of 30 seconds at 3000 rpm (Benchmark Scientific, 422V16). RNA was purified from homogenized tissue using the Direct-Zol RNA Miniprep kit (Zymo Research ...
-
No products found
because this supplier's products are not listed.
Anja Kopp, et al.,
bioRxiv - Biochemistry 2023
Quote:
Screening of crystallization conditions for wild type GSDMD and GSDMDΔ184-194/Δ247-272 in complex with nanobodies VHHGSDMD-1 to VHHGSDMD-6 and the combination of VHHGSDMD-2 plus VHHGSDMD-6 was performed using commercial kits from Molecular Dimensions (Maumee, OH, USA) and Jena Bioscience (Jena ...
-
No products found
because this supplier's products are not listed.
Ericka Kirkpatrick Roubidoux, et al.,
bioRxiv - Immunology 2023
Quote:
... and N (AcroBiosystems, Cat No. NUN-S41) were added at high (30µg/mL ...
-
No products found
because this supplier's products are not listed.
Jennifer A. Rinker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mice were deeply anesthetized with vaporized isoflurane (1-3%, SomnoSuite Vaporizer, Kent Scientific) and 200 nl of AAV1-CaMKII-GCaMP6f (Addgene ...
-
No products found
because this supplier's products are not listed.
Keith A. Breau, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 1 mL cold neutralized collagen solution was added to 6-well tissue culture plates (Genesee 25-105) pre-warmed to 37 °C ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Roy A. Ehling, et al.,
bioRxiv - Immunology 2021
Quote:
Transfected cells were sorted for HDR+ by staining for Strep-Tactin-APC 1:100 (IBA lifesciences, Cat: 6-5010-001) and anti-hIgG AF488 1:100 (Jackson ImmunoResearch ...