-
No products found
because this supplier's products are not listed.
Julia L. Daiß, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Top2a was obtained from Inspiralis (c/n HT210). Proteins were incubated together in pulldown buffer (25 mM TrisHCl pH7.9 ...
-
No products found
because this supplier's products are not listed.
Hassan E. Eldesouky, et al.,
bioRxiv - Microbiology 2019
Quote:
... and 6-Gingerol were obtained from Ark Pharm (Arlington Heights, IL). Atorvastatin was obtained from Selleckchem (Radnor ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Anurag Pandey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anaesthetised mice were secured in a Narishige SR-6 stereotaxic frame (Narishige International, London, UK); the skull was thinned over a 2 x 2mm area above the barrel-field centerd on the D1 barrel (at approximately 3mm lateral to the midline and 1.5 mm caudal to bregma) ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
We printed our arrays with the PDC70 type 3 nozzle (Scienion) due to its reduced dispense volume and the specific hydrophobic coating optimized to improve the dispense stability of protein solutions ...
-
No products found
because this supplier's products are not listed.
Shang-Xiang Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
3-Bromo-1,1,1-trifluoroacetone (BFA) (J&K Scientific, catalog number 312226) were dissolved in DMSO to 5 M concentration as a stock solution ...
-
No products found
because this supplier's products are not listed.
Sufeng Zhang, et al.,
bioRxiv - Bioengineering 2023
Quote:
The distal colon was homogenized in 1:20 (w/v) of 50 mM phosphate buffer (pH = 6) containing 0.5% hexadecyltrimethyl ammonium bromide on ice using a homogenizer (Bertin Corp., Precellys).
-
No products found
because this supplier's products are not listed.
Sei Motouchi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... was incubated in 5 mM Tris-HCl buffer (pH 7.5) containing each substrate (1% glucomannan, Neogen, MI, USA; 1% polygalacturonic acid, Neogen; 1% carboxymethyl cellulose ...
-
No products found
because this supplier's products are not listed.
Gemma L. Pearson, et al.,
bioRxiv - Cell Biology 2022
Quote:
... blocked for 1 h at room temperature with 1 X Blocking One solution (Nacalai USA Inc; San Diego, CA, USA). Sections were then incubated in the following primary antisera overnight at 4°C in 1 X PBS + 1% tween + 20% Blocking One solution ...
-
No products found
because this supplier's products are not listed.
Pranay Mandal, et al.,
bioRxiv - Neuroscience 2020
Quote:
Rhodamine-phalloidin (#6876, 1:125, Setareh Biotech, USA) was added along with secondary antibody during immunocytochemistry.
-
No products found
because this supplier's products are not listed.
Chaim Glück, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a glass pipette was inserted into the lumen of the MCA and 1 μL of thrombin (1 UI; HCT-0020, Haematologic Technologies Inc) was injected to induce in situ clot formation (Fig ...
-
No products found
because this supplier's products are not listed.
Stavroula Bitsi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... containing 1 mg/mL collagenase from Clostridium histolyticum (S1745602, Nordmark Biochemicals), dissected ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Paraffin-embedded tissue sections (15 µm) of human articular cartilage from healthy (n=5) and OA-positive (n=6) anonymized donors were used (Articular Engineering, IL). Sections were immunolabeled with Piezo1-antibody (NBP1-78537 ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The estradiol levels (n=4) were also measured using an ELISA assay (#ES180S-100 Calbiotech, detection range 3 to 300 pg/mL). The intra-assay variation was 5.9% in these assays.
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Linlin Yang, et al.,
bioRxiv - Immunology 2020
Quote:
Transgenic larvae were injected at 3 dpf intravenously with 1 nL clodronate liposomes (Liposoma) supplemented with Alexa 568 conjugated dextran (10 kDa ...
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Dieter G. Müller, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Colchicine treatment was performed using a disk of filter paper of 6 mm diameter loaded with 1 mg of colchicine (Fluka, Honeywell Research Chemicals), which was placed in the centre of an agar plate filled with gametophyte material ...
-
No products found
because this supplier's products are not listed.
Sarah A. Nordeen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Derivative crystals were obtained by applying 0.2ul of 0.1M [TeW6O24]6- (MiTeGen) to drops containing Nup84-Nup133CTD-VHH-SAN8 crystals ...
-
No products found
because this supplier's products are not listed.
Jennifer McDonald, Catherine J. Merrick,
bioRxiv - Microbiology 2021
Quote:
Mature schizont cultures at >6% parasitaemia were synchronised using 55% Nycodenz (Alere technologies AS). Cultures were centrifuged and media removed to leave 2ml of media and blood ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Neha Ahuja, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Genotypes were determined by polymerase chain reaction (PCR) after O/N digestion using DirectPCR (Tail) Lysis buffer (Viagen, Los Angeles, CA) per manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Satoru Hoshino, et al.,
bioRxiv - Zoology 2021
Quote:
We measured the body mass of all animals before and after the sampling periods in each experiment (N. larvatus: Digital Platform Scale, DP-8100, Yamato, Japan; T. cristatus: SD75LJP, OHAUS Corporation, USA), by offering weighing platforms on which the animals stepped voluntarily.
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Maho Nakazawa, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Plasma histamine and mMCP-6 levels were measured using a histamine EIA kit (Bertin Bioreagent, Montigny-le-Bretonneux, France) and Mcpt6 ELISA kit (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Grzegorz Maciag, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After antibody staining the tissue was washed 6 times in PBS and before imaging the tissue was incubated in RapiClear (SUNJin Lab) for 30-60 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
G. Caplen, S.D.E. Held,
bioRxiv - Zoology 2021
Quote:
Saliva was collected (Day 3) using a cotton swab (SalivaBio Children’s Swab, Item No. 5001.06, Salimetrics) and then immediately stored at −80°C prior to analysis ...
-
No products found
because this supplier's products are not listed.
Mary E. Herndon, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Endogenous peroxidase activity was quenched with 3% hydrogen peroxide and Background Buster (Innovex Biosciences; Richmond, CA) was used to block non-specific staining ...
-
No products found
because this supplier's products are not listed.
Alessandro Gori, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The detector antibody (biotinylated CD9, CD63, CD81 antibodies by Ancell or anti-band 3 from Santa Cruz) solutions (0.3 µg/ml ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Aline Sardinha-Silva, et al.,
bioRxiv - Immunology 2019
Quote:
... fibroblast stimulating ligand-1 (FSL-1; EMC Microcollections), or LPS Ultrapure (standard LPS ...
-
No products found
because this supplier's products are not listed.
Tatsuaki Kurata, et al.,
bioRxiv - Microbiology 2021
Quote:
... Next day the plasmid was extracted from 3 mL of the culture using Favorprep Plasmid Extraction Mini Kit (Favorgen Biotech Corp.). 500 ng of the plasmid mix was again transformed into BW25113 carrying a toxin expression plasmid and let to recover as before ...
-
No products found
because this supplier's products are not listed.
Albéric A. de Lajarte, et al.,
bioRxiv - Biochemistry 2024
Quote:
... adding a T7 promoter sequence at the forward primer (5′ TAATACGACTCACTATAG 3′) using a 2X PCR PreMix (Syd Labs, Cat. MB067-EQ2N), human cDNA (ZYAGEN ...
-
No products found
because this supplier's products are not listed.
Martin L. Read, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... AP2α1 (1:400; Antibodies.com), AP2μ2 (1:500 ...
-
No products found
because this supplier's products are not listed.
Martin F. Orth, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... monoclonal mouse anti-PD-1 antibody (1:80; 315M-96, MEDAC, Wedel, Germany), and monoclonal mouse anti-Ki-67 antibody (M7240 ...
-
No products found
because this supplier's products are not listed.
Carole J Kuehl, et al.,
bioRxiv - Microbiology 2019
Quote:
... anti-Shigella FITC (1/1000, Virostat), and anti-mouse E-cadherin (1/100 ...
-
No products found
because this supplier's products are not listed.
Miner Deng, et al.,
bioRxiv - Microbiology 2023
Quote:
... and Sporo-Glo (Waterborne, 1:20) for 60 min ...
-
No products found
because this supplier's products are not listed.
Jimin Yoon, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 1 µg/mL of upadacitinib (MedKoo Biosciences), was treated 1 h prior to poly I:C transfection ...
-
No products found
because this supplier's products are not listed.
Sean K. Wang, Yunlu Xue, Constance L. Cepko,
bioRxiv - Neuroscience 2021
Quote:
... or 1:500 of anti-SIRPα (QED Bioscience) in blocking solution overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Sabina Marciano, et al.,
bioRxiv - Neuroscience 2021
Quote:
... primary antibody incubation was performed for 24 h at room temperature (VMAT2: 1:5000, 20042, Immunostar, Hudson, USA, HA-tag: 1:5000, MMS- 101R, Nordic BioSite, Taby ...
-
No products found
because this supplier's products are not listed.
John M. Thomas III, et al.,
bioRxiv - Pathology 2019
Quote:
Mounted sections of tissue were incubated in PBTB (sterile PBS + .01% Tween20 + 0.2% BSA) for 1 hour followed by incubation in 1:500 dilution of primary antibody (Arigo Biolaboratories, Taiwan) for either 1 hour at room temperature or overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
CAD cells were maintained in a 1:1 mix of DMEM and F12 (Thermo 11320033) supplemented with 10% Equafetal (Atlas Biologicals EF-0500-A) and penicillin-streptomycin (Thermo 15140122) ...
-
No products found
because this supplier's products are not listed.
Francisco J. Calero-Cuenca, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-Myc 1:200 (Alfagene/Life Technologies #13-2500). The secondary antibodies (1:600 dilution ...
-
No products found
because this supplier's products are not listed.
Vesa Havurinne, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The same area where FV/FM was measured (approximately 1 cm2) was cut out of the leaves/algal clusters and placed in a 1 ml Dounce tissue grinder (DWK Life Sciences, Millville, NJ, USA) filled with 0.5 ml of osmotic shock buffer (Table 1 ...
-
No products found
because this supplier's products are not listed.
Sophie E. Cousineau, et al.,
bioRxiv - Microbiology 2022
Quote:
... mouse anti-HCV core (clone B2, Anogen MO-I40015B, 1:7,500); mouse anti-JFH-1 NS5A (clone 7B5 ...
-
No products found
because this supplier's products are not listed.
Till S. Harter, et al.,
bioRxiv - Physiology 2021
Quote:
... and 1% normal goat serum (Lampire Biological Laboratories 7332500; Pipersville, USA) in PBS and incubated for six hours on a rotator ...
-
No products found
because this supplier's products are not listed.
Ella N Hartenian, Britt A Glaunsinger,
bioRxiv - Microbiology 2019
Quote:
... or anti-ORF59 antibody (Advanced Biotechnologies 13-211-100 at 1:200) in 5% BSA overnight at 4 °C ...