-
No products found
because this supplier's products are not listed.
Eileen M. Lynch, et al.,
bioRxiv - Pathology 2024
Quote:
... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Latha Muniappan, et al.,
bioRxiv - Pathology 2020
Quote:
Calpain-2 immunostaining was performed using a rabbit anti-human calpain-2 (10 µg/ml, catalog No. RP-3 Calpain-2; Triple Point biologics, Forest Grove, OR). CD68 immunostaining was performed using a rabbit anti-human CD68 antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Hiroki Miyahara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and stained with 4ʹ ,6-diamidino-2-phenylindole (DAPI) for 10 min prior to mounting in FluoromountTM (K024, Diagnostic BioSystems, California, USA). Samples for ThT staining were treated with 1% ThT for 3 min and differentiated in 1% acetic acid for 15 min ...
-
No products found
because this supplier's products are not listed.
Clara Taffoni, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cGAMP enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer’s protocol using the Cayman Chemical 2′3′-cGAMP ELISA Kit (Bertin Bioreagents).
-
No products found
because this supplier's products are not listed.
Yeranuhi Hovhannisyan, et al.,
bioRxiv - Pathology 2023
Quote:
... and CW30318 (Control 2, Fuji Cellular Dynamics) derived from healthy individuals without any cardiac pathology ...
-
No products found
because this supplier's products are not listed.
Julio C.Y. Liu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... ML-792 (SUMOi; 2 μM, MedKoo Biosciences), MLN-7243 (Ub-E1i ...
-
Jeanette M. Metzger, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Acrylate-mPEG (Ac-mPEG, 2 kDa) and acrylate-PEG-maleimide (Ac-PEG-Mal, 2 kDa) were acquired from Biochempeg Scientific Inc ...
-
No products found
because this supplier's products are not listed.
Bukola Adeoye, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plasma levels of Herpes simplex virus 1/2 (HSV-1/2) and Clostridium tetani (tetanus)-toxoid-specific IgG were captured and measured with ELISA kits from Calbiotech and Alpha diagnostics according to manufacturers’ protocols.
-
No products found
because this supplier's products are not listed.
Benedict Edward Mc Larney, et al.,
bioRxiv - Cancer Biology 2022
Quote:
The fluorescence emission spectra of pHLIP ICG was assessed in the presence of and without POPC (1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine) liposomes (100nm in size, T&T Scientific Corp, TN, USA). pHLIP ICG has previously shown a high NIR fluorescent state when bound to liposomes and low NIR fluorescent state without the presence of liposomes enabling in vitro testing.(47 ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals). Non-phosphorylated Ub protein (Boston Biochem ...
-
No products found
Ons Mamai, et al.,
bioRxiv - Cell Biology 2022
Quote:
... After blocking the membrane for 1h at RT with AdvanBlock (Advansta®), and proteins were detected by incubation with relevant antibodies (Supplementary Table S6 ...
-
Cat# IMS206_Giardia-3X,
USD $1980.0/kit
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Clémence Boutry, et al.,
bioRxiv - Microbiology 2022
Quote:
... and on 2 June (only ‘Otava’, ‘Rajika’, ‘Rubinola’, and ‘Boskoop’). Trees with spore traps were excluded from receiving fungicide treatments in 2019 and 2020 ...
-
No products found
because this supplier's products are not listed.
Andrew Chase, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Rabbit anti-FLAG (Signalway Antibody LLC, Maryland, USA; T503-2), tubulin (Abcam ...
-
No products found
because this supplier's products are not listed.
Hiroshi Yamaguchi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Methylated gold nanoparticles (final 1:2 dilution; CGM2K-15-25, Cytodiagnostics) were added as fiducial markers ...
-
No products found
because this supplier's products are not listed.
Alden M. Shoup, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the probe shank was submerged in freshly made 2% Tergazyme (Alconox Inc.) dissolved in deionized (DI ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Kelli K. Mullane, et al.,
bioRxiv - Microbiology 2022
Quote:
... fitted with a pressurizable 2-leg rubber septum (DWK Life Sciences, New Jersey, USA) was filled completely with low percentage (0.3% ...
-
No products found
because this supplier's products are not listed.
Mustafa G. Aydogan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 2) The mCherry tag was replaced with either mNeonGreen (Shaner et al., 2013) (Allele Biotechnology) or mKate2 (Shcherbo et al. ...
-
No products found
because this supplier's products are not listed.
Lina Marcela Carmona, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 2 wells of 10 pg of Mouse Whole Brain Total RNA (Zyagen, MR-201) and 2 wells of 10 pg Control RNA provided in the Takara kit.
-
D-Lactate Assay Kit (EDLC-100)
Cat# EDLC-100,
1.0 kit, 100 tests, USD $359.0
Ask
Liliana M. Sanmarco, et al.,
bioRxiv - Immunology 2023
Quote:
Pyruvate levels were quantified in BMDC lysates after 1h stimulation using EnzyChrom pyruvate assay kit (EPYR-100, BioAssay Systems), followed the procedure suggested by the manufacturer ...
-
No products found
because this supplier's products are not listed.
S Ghoroghi, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... 2 ml of concentrated extracellular medium were applied on top of a qEV column (Izon Science) and 6 ml fractions were collected ...
-
No products found
because this supplier's products are not listed.
Natalie J. Norman, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 999 ± 2 µg/ml in 0.2% (v/v) HNO3(CGC1) inorganic carbon standard (Inorganic Ventures, USA). All other chemicals and salts were trace metal grade (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Nora Schmidt, et al.,
bioRxiv - Microbiology 2020
Quote:
... and quantified with the LightMix Assay SARS-CoV-2 RdRP RTqPCR assay kit (TIB MOLBIOL, Germany) and the RNA Process Control kit (Roche) ...
-
No products found
because this supplier's products are not listed.
Nikhil Pandey, Priyanka Mishra,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The intensity of COX-2 was determined using image quant Omega Flour TM (GEL Company, USA) using Omega Fluor Acquisition software ...
-
No products found
because this supplier's products are not listed.
Aubin Ramon, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SarS-CoV-2 RBD was purchased as biotinylated purified protein from CUSABIO (product code CSB-MP3324GMY1-B) and stored at -80 °C.
-
No products found
because this supplier's products are not listed.
Zhimin Liu, et al.,
bioRxiv - Systems Biology 2020
Quote:
... ∼7.4 × 109 of frozen cells were inoculated into 1.2 L media in a 2 L Delong flask (Bellco). The cells were grown for a total of 21 generations ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Lina Sui, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Perifusate samples were collected at the outlet at flow rate of 200 μl/min and every 2 min samples were used to determine insulin concentration by Mercodia Ultrasensitive Human Insulin ELISA kit.
-
No products found
because this supplier's products are not listed.
Susan Paton, et al.,
bioRxiv - Microbiology 2021
Quote:
... RT-PCR was performed using the VIASURE SARS-CoV-2 Real Time PCR Detection Kit (Viasure; CerTest Biotec, Zaragoza, Spain), following the methods provided ...
-
No products found
because this supplier's products are not listed.
Jared O. Kroll, et al.,
bioRxiv - Biochemistry 2023
Quote:
... streptavidin enrichment and tryptic digestion were performed as previously described.58 Peptides (25 μL) were transferred to 200 μL volume AQ brand silanized glass vial inserts in 2 mL glass autosampler vials (MicroSolv) and stored at −20 °C.
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Natalie C. Butterfield, et al.,
bioRxiv - Genetics 2019
Quote:
... harboring alanine/alanine or threonine/threonine polymorphisms for the deiodinase 2 gene at codon 92 (Dio2Ala92, n=9 and Dio2Thr92, n=10) were generated by Applied Stemcell Inc ...
-
No products found
because this supplier's products are not listed.
Andrew S. Bray, et al.,
bioRxiv - Microbiology 2021
Quote:
... and the suspension serially diluted and plated onto LB agar plates (Fisher, BP9745-2) In between sampling the plates were sealed with parafilm (Bemis, PM-999) and placed in the dark at room temperature.
-
No products found
because this supplier's products are not listed.
Frank Hay, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Two hundred seeds per seedlot were placed (without surface-sterilization) on 2% water agar (20 g/liter agar; Hardy Diagnostics, Santa Maria, CA) + 0.2 g/liter ampicillin ...
-
No products found
because this supplier's products are not listed.
Jessica Trinh, et al.,
bioRxiv - Plant Biology 2023
Quote:
... water was replaced with 500 μL of either water or water containing MAMP before pressure-infiltrating for 2 minutes at 30 mm Hg in a vacuum desiccator (SP Bel-Art #F42025-0000). Leaf disks were collected at 0 ...
-
No products found
because this supplier's products are not listed.
Thomas Rowe, et al.,
bioRxiv - Microbiology 2024
Quote:
... 180 uL of HEK-λ cells were added to each well containing twenty uL of sample and to serially 1/2-log diluted (0.1 – 1000 ng/mL) recombinant ferret IFNL3 (Kingfisher Biotech, St. Paul, MN, USA). The plates were incubated for 20Hr at 37°C ...
-
No products found
because this supplier's products are not listed.
Mikel Garcia-Marcos, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Fluorescein di-β-D-galactopyranoside (FDG) was from Marker Gene Technologies, and the protein inhibitor mixture was from Sigma (catalog no ...
-
No products found
because this supplier's products are not listed.
Sarah A. Nordeen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Derivative crystals were obtained by applying 0.2ul of 0.1M [TeW6O24]6- (MiTeGen) to drops containing Nup84-Nup133CTD-VHH-SAN8 crystals ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Daisuke Shimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
... using Mouse Mitochondrial DNA Copy Number Assay kit (Detroit R&D, Detroit, MI) for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
José R Pittaluga, et al.,
bioRxiv - Immunology 2024
Quote:
... A PVP-free polycarbonate membrane (3 µm pore size; Neuro Probe Inc. Gaithersburg MD, USA) separated cells from lower wells containing either RPMI or the stimulus (pRNA or CM) ...
-
No products found
because this supplier's products are not listed.
Katelyn J. Hoff, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Amaxa-nucleofected neurons plated at 500,000 cells per 35mm poly-D-lysine-coated glass bottom dish (WillCo Wells, HBST-3522) in MEM containing 10% Fetal Bovine Serum (FBS ...