-
No products found
because this supplier's products are not listed.
Hao Wang, et al.,
bioRxiv - Biochemistry 2024
Quote:
The gel was prepared with a concentration of 6% (wt/vol) agarose (HydraGene Co. ...
-
No products found
because this supplier's products are not listed.
Xiao Lin, et al.,
bioRxiv - Plant Biology 2020
Quote:
A BAC library of plant GIG362-6 was generated by Bio S&T (Canada). A BAC clone that spans the mapping interval was isolated using molecular markers (Table S2 ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Bukola Adeoye, et al.,
bioRxiv - Microbiology 2022
Quote:
... Plasma levels of Herpes simplex virus 1/2 (HSV-1/2) and Clostridium tetani (tetanus)-toxoid-specific IgG were captured and measured with ELISA kits from Calbiotech and Alpha diagnostics according to manufacturers’ protocols.
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Bianca Scolaro, et al.,
bioRxiv - Immunology 2023
Quote:
... Mice were injected intraperitoneally (i.p.) with either D-glucose (Crystalgen 300-341-1000) at 2g per kg of body weight ...
-
No products found
because this supplier's products are not listed.
Shuyong Jia, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The classic LDFs of both control points (points 1 and 2) were recorded by a PeriFlux 5000 (Perimed AB, Stockholm, Sweden) system with a 64-Hz sampling rate ...
-
No products found
because this supplier's products are not listed.
Ilayda Ates, et al.,
bioRxiv - Bioengineering 2023
Quote:
Liver tissues from transplanted mice were homogenized in saline using a D-160 homogenizer (Scilogex). The genomic DNA was extracted from homogenized liver tissues using the MasterPure Complete DNA and RNA Purification kit (Lucigen ...
-
No products found
because this supplier's products are not listed.
Saige Lorraine Pompura, et al.,
bioRxiv - Immunology 2020
Quote:
... NEFA concentration in plasma and WAT (chloroform:methanol extraction 2:1) were determined using the WAKO HR Series NEFA-HR2 in vitro enzymatic colorimetric assay (FUJIFILM Wako Diagnostics, USA).
-
No products found
because this supplier's products are not listed.
Sebastian Schaefer, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2-(butylthiocarbonothioylthio)propanoic acid (BTPA, Boron Molecular) and 5,10,15,20-tetraphenyl-21H,23H-porphine zinc (ZnTPP ...
-
No products found
because this supplier's products are not listed.
Haichao Guo, et al.,
bioRxiv - Plant Biology 2020
Quote:
... wrapped around the root-shoot junction with L800-D Identi-Plugs foam (Jaece Industries, NY, USA), plugged in a 15 mL conical centrifuge tube (VWR ...
-
Jeanette M. Metzger, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Acrylate-mPEG (Ac-mPEG, 2 kDa) and acrylate-PEG-maleimide (Ac-PEG-Mal, 2 kDa) were acquired from Biochempeg Scientific Inc ...
-
No products found
because this supplier's products are not listed.
Victoria L. Messerschmidt, et al.,
bioRxiv - Bioengineering 2021
Quote:
Poly(D, L-lactide-co-glycolic acid) nanoparticles (PLGA, 50:50, Akina Inc., West Lafayette, IN, USA) of two different molecular weights including 55–65 kDa (HMW Nanoparticles ...
-
No products found
because this supplier's products are not listed.
Yumaine Chong, Ellis Cooper,
bioRxiv - Neuroscience 2022
Quote:
... was injected into the anterior chamber of the eye using a 33G x 1/2” TSK SteriJect hypodermic needle (Air-Tite Products, Virginia Beach, VA) fitted onto a 25μL Gastight Hamilton syringe (Hamilton Company ...
-
The enzyme, characterized from the bacterium Pseudomonas putida SQ1, participates in a...
Cat# EXWM-5003,
100 ug, contact supplier for pricing
Ask
Junfei Ma, Shuying Wang, Qianyu Ji, Qing Liu,
bioRxiv - Immunology 2021
Quote:
... pylori urease (2 μg in 50 μL, Creative Enzymes, USA) was incubated with purified IgG antibodies (64 μg/well ...
-
No products found
because this supplier's products are not listed.
Clémence Boutry, et al.,
bioRxiv - Microbiology 2022
Quote:
... and on 2 June (only ‘Otava’, ‘Rajika’, ‘Rubinola’, and ‘Boskoop’). Trees with spore traps were excluded from receiving fungicide treatments in 2019 and 2020 ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Tilman Busch, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... The analytical column was self-packed with silica beads coated with C18 (Reprosil Pur C18-AQ, d = 3 Â) (Dr. Maisch HPLC GmbH, Ammerbusch, Germany). For peptide separation ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Rayan Haroun, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mambalgin-1 (Smartox) was dissolved in PBS and was used at a dose of 34µM via intrathecal injection ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Nikhil Pandey, Priyanka Mishra,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The intensity of COX-2 was determined using image quant Omega Flour TM (GEL Company, USA) using Omega Fluor Acquisition software ...
-
No products found
because this supplier's products are not listed.
Penghao Xu, et al.,
bioRxiv - Genomics 2023
Quote:
... neutralization using 2 M HCl and purification using HighPrep™ RNA Elite Clean-up System (MagBio Genomics) was performed ...
-
No products found
because this supplier's products are not listed.
Jini Sugatha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-CD8(153-020,Ancell,IF, 1:500, Live imaging, 1:300), anti-CIMPR (ab124767 ...
-
No products found
because this supplier's products are not listed.
Shannon J. McKie, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1 mM DTT and 1 mM ATP) and 2.5 nM negatively supercoiled pBR322* (Inspiralis) or singly-linked catenanes (Inspiralis ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Stephanie H Chen, et al.,
bioRxiv - Genomics 2021
Quote:
... A pilot run on an Illumina iSeq 100 with 2 x 150 bp paired end sequencing run was performed for QC using hic_qc v1.0 (Phase Genomics, 2019) with i1 300 cycle chemistry ...
-
No products found
because this supplier's products are not listed.
Jared O. Kroll, et al.,
bioRxiv - Biochemistry 2023
Quote:
... streptavidin enrichment and tryptic digestion were performed as previously described.58 Peptides (25 μL) were transferred to 200 μL volume AQ brand silanized glass vial inserts in 2 mL glass autosampler vials (MicroSolv) and stored at −20 °C.
-
No products found
because this supplier's products are not listed.
Eric Esposito, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The RNA was further purified by twice mixing the aqueous supernatant with 700 μL of acidic phenol chloroform and centrifuging the solution in a 5Prime Phase Lock Gel Heavy 2 ml tube (Andwin Scientific) at 16,000 rcf to separate the phases ...
-
No products found
because this supplier's products are not listed.
Clara M. Herrera, et al.,
bioRxiv - Microbiology 2024
Quote:
... Digested peptide samples were acidified to 0.5% TFA (ph<2) with 10% TFA stock and desalted using C18 ultra micro spin columns (The Nest Group).
-
No products found
because this supplier's products are not listed.
Weng Hua Khoo, et al.,
bioRxiv - Immunology 2022
Quote:
... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
No products found
because this supplier's products are not listed.
Raphael Lutz, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... in fresh human BM samples was performed according to the highly standardized flow cytometry approach developed and described by the Spanish Myeloma Collaborative Group using a commercially available EuroFlow 8-color 2-tube MM MRD Kit (Cytognos, Salamanca, Spain) [38] ...
-
No products found
because this supplier's products are not listed.
Dominique Vanhecke, Viola Bugada, Thorsten Buch,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Both MOE and SOE emulsions were freshly made on the day of treatment by emulsification during 10 minutes at room temperature using 2 mL Luer-Lock syringes (Braun # 4606701V) connected with a one-way Luer female to female adaptor (Cadence Science #6521IND).
-
No products found
because this supplier's products are not listed.
Rebecca Guth-Metzler, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1 µL of each reverse transcription was combined with 1 µL GenefloTM 625 size standard ROX ladder (CHIMERx) and 20 µL HiDi (Applied Biosystems) ...
-
No products found
because this supplier's products are not listed.
Florencia Rammauro, et al.,
bioRxiv - Microbiology 2024
Quote:
... Cells were further incubated 1 h at RT with monoclonal antibodies anti-p24 (BLV3, 1/200, VMRD, USA). After three washes with PBS ...
-
No products found
because this supplier's products are not listed.
Surya D. Aggarwal, et al.,
bioRxiv - Microbiology 2019
Quote:
... J774A.1 cells were certified by IDEXX BioAnalytics (Columbia ...
-
No products found
because this supplier's products are not listed.
Rahul Sharma, Martin W. Hetzer,
bioRxiv - Cell Biology 2022
Quote:
... mouse Nesprin3 (Nordic-MUBio # MUB1317P,1:250); rabbit Emerin D3B9G XP (CST # 30853) ...
-
No products found
because this supplier's products are not listed.
Peng V. Wu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... CK19 (rabbit, 1:100, Abbomax 602-670), Ki-67 (rat ...
-
No products found
because this supplier's products are not listed.
Blanca M. Perez-Sepulveda, et al.,
bioRxiv - Microbiology 2020
Quote:
... selecting either a “scoop” with a 10 μL plastic loop taken from a bacterial glycerol (50% v/v) stock or 2 beads of bacteria stored at −80°C in a Microbank tube™ cryotubes (Pro-Lab Diagnostics). The samples were grown at 37°C and 220 rpm overnight in either 100 or 200 μL LB (1% tryptone ...
-
No products found
because this supplier's products are not listed.
Anouschka S. Ramsteijn, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Cages were enriched with wooden stick for gnawing (10×2×2cm) and nesting material (Enviro-dri™, Shepherd Specialty Papers, Richland, MI, USA), and were cleaned weekly ...
-
No products found
because this supplier's products are not listed.
Ming Yang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit anti-total Rac1 (1:10; NewEast Biosciences); mouse anti-CD44 (1:100 ...
-
No products found
because this supplier's products are not listed.
Zaghi Mattia, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 1× Titan HotTaq EvaGreen qPCR Mix (Bioatlas, Estonia), and 0.4 mM of each primer ...
-
No products found
because this supplier's products are not listed.
Lucie Peskova, et al.,
bioRxiv - Molecular Biology 2020
Quote:
At least 12 pooled retinal organoids per sample were homogenised using a 1 ml insulin syringe in 1 ml RNA Blue Reagent (an analogue of Trizol) (Top-Bio), followed by chloroform RNA extraction ...
-
No products found
because this supplier's products are not listed.
Eric E. Gardner, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and Fc receptor blocker reagent (Innovex Biosciences; 1:25). Slides were then briefly washed in TBST and primary antibodies were incubated overnight in blocking buffer at 4C in a humidified chamber ...
-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Hirofumi Fujita, Takashi Kodama, Sascha du Lac,
bioRxiv - Neuroscience 2020
Quote:
... local field potential was also monitored through extracellular amplifier (ER-1, Cygnus, bandpass frequency range 1-3000 Hz, Cygnus Technology, Delaware Water Gap, PA), 50/60 Hz noise eliminator (HumBug ...
-
No products found
because this supplier's products are not listed.
Shayna Seenayah, Nofre Sanchez, Ursula M Paredes,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
... The Salivary Cortisol Immunoassay chosen (Assay #1-3002, Salimetrics, USA) has been validated for measuring cortisol in primate hair (Meyer et al. ...
-
No products found
because this supplier's products are not listed.
Jill V. Hagey, et al.,
bioRxiv - Microbiology 2021
Quote:
... and energy content (Cumberland Valley Analytical Services, Hagerstown, MD; Table 1).
-
No products found
because this supplier's products are not listed.
Kara Poole, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Fixed cells were blocked with 1% bovine serum albumin fraction V (Equitech-Bio, Kerrville, TX) in PBS for 1 hour at room temperature ...