-
No products found
because this supplier's products are not listed.
Galina A. Gusarova, et al.,
bioRxiv - Physiology 2021
Quote:
... we synthesized nitrilotriacetic acid (NTA) to the N-terminus of TAT (amino acids 48-60, CHI Scientific, Maynard, Mass.). Then ...
-
No products found
because this supplier's products are not listed.
Josua Oderbolz, et al.,
bioRxiv - Immunology 2021
Quote:
... M25 peptide (amino acid sequence: NHLYETPISATAMVI) was purchased from EMC microcollections (Tübingen, Germany) and 20 μg of the M25 peptide in 0.5% DMSO in 1x PBS solution were injected i.v ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Yiran Wei, et al.,
bioRxiv - Neuroscience 2021
Quote:
All patients underwent maximal safe surgery using 5-aminolevulinic acid fluorescence (5-ALA, Medac, Stirling, UK) and neuro-navigation (StealthStation ...
-
No products found
because this supplier's products are not listed.
Ava Niazi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Antibody to TECTA was raised to peptides based on the predicted amino acid sequence of the mouse TECTA protein (CYNKNPLDDFLRPDGR) and was purified by antigen specific affinity purification by Abfrontier (www.gwvitek.com). The purified antibody (1 mg/ml ...
-
No products found
because this supplier's products are not listed.
Saadia Hasan, et al.,
bioRxiv - Neuroscience 2023
Quote:
Human i3Neurons were maintained on PLO coated 12-well dishes in light amino acid-containing media (DMEM:F12 for SILAC medium (Athena Enzyme Systems #0423), N2 Supplement (Life Technologies Corporation #17502048) ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Flávia Viana, et al.,
bioRxiv - Microbiology 2022
Quote:
... 10-4 and 10-6 were automatically plated using easySpiral® automatic plater (Interscience, France) in triplicates on BCYE agar ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C57BL/6 2-month-old mouse blood preserved with ACD 20% on ice was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
Alberto Perez-Alvarez, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 4 μM cytosine β-D-arabinofuranoside added 48 hours after plating in 6 mm diameter cloning cylinders (Ace Glass).
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 0.5 μg of AMAC-conjugated disaccharide samples and standard disaccharides (hyaluronic acid – HA, non-sulfated chondroitin - C0S, C4S, C6S; Seikagaku) were separated on a 30% polyacrylamide gel in Tris Glycine buffer for 30-40 min.
-
No products found
because this supplier's products are not listed.
Bruno Motta Nascimento, Nikhil Unni Nair,
bioRxiv - Bioengineering 2020
Quote:
... coli were hydrolyzed 6 M HCl at 100 °C for 4 h in a vacuum sealed tube (Chemglass, #CG-4025-01). Acid was immediately removed with a vacuum centrifuge and pellet was resuspended in deionized water ...
-
No products found
because this supplier's products are not listed.
Ying Zhan, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Acid-terminated PLGA (Mw: 25,000 g mol−1, 50:50 lactic acid:glycolic acid, acid end‐capped, Akina Inc. PolySciTech, West Lafayette, IN) was dissolved with dimethylformamide (DMF ...
-
No products found
because this supplier's products are not listed.
Ana Belen Lopez-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mice (n=6) underwent stereotaxic surgery to implant MBR-5 intracerebral guide cannulae (ID 457μm, OD 635 μm; BASi Research Products, USA) into the striatum ...
-
No products found
because this supplier's products are not listed.
Tamjid A Chowdhury, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Naphthaleneacetic acid (K-NAA) (Phytotechnology Laboratories) was dissolved in double distilled water to obtain 250 mM K-NAA solution and filter-sterilized by passing through 25 mm sterile syringe filter (Pall Corporation) ...
-
No products found
because this supplier's products are not listed.
Gabriel Brawerman, et al.,
bioRxiv - Cell Biology 2021
Quote:
... aliquots of the low and high glucose supernatants and the insulin content extracts were collected and spun at 3000g for 5 minutes at 4°C and stored at −20°C or used immediately for mouse or human insulin ELISAs (Mercodia) with appropriate dilutions (1:10-1:50 for supernatants ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Zengqi Zhao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... fatty acid free BSA (Equitech-Bio, USA) was dissolved in FBS-free DMEM at room temperature according the ratio 1:100 (1 g fatty-acid free BSA ...
-
No products found
because this supplier's products are not listed.
Limin Shang, et al.,
bioRxiv - Genomics 2020
Quote:
... The PCR reactions were performed with I-5™ 2×High-Fidelity Master Mix (MCLAB, TSINGKE Biological Technology, China) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shikai Hu, et al.,
bioRxiv - Pathology 2021
Quote:
Total hepatic bile acids were measured using the Mouse Total Bile Acids Assay Kit from Crystal Chem (Downers Grove, IL), as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Cristina Godinho-Silva, et al.,
bioRxiv - Immunology 2019
Quote:
... Whole-mount samples were incubated overnight or for 2 days at 4°C using the following antibodies: anti-Tyrosine hydroxylase (TH) (Pel-Freez Biologicals) and anti-GFP (Aves Labs) ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Zoology 2020
Quote:
... gel containing 1× RedSafe Nucleic Acid Staining Solution (FroggaBio) and electrophoresed in 1× Tris-Acetate-EDTA (TAE ...
-
No products found
because this supplier's products are not listed.
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... Hoechst 33342 Fluorescent Nucleic Acid Stain (#639, ImmunoChemistry Technologies, 1:200), goat anti-rabbit IgG(H+L ...
-
No products found
because this supplier's products are not listed.
Maud de Dieuleveult, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and TET2 (R1086-4; Abiocode). The immunoprecipitated complexes were eluted in Laemmli buffer.
-
No products found
because this supplier's products are not listed.
S. Hong Chan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 5’ Gppp- cap and 5’ m7Gppp- cap are synthesized by Bio-synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Robert L. McPherson, et al.,
bioRxiv - Biochemistry 2022
Quote:
... or YCFAC medium (Yeast Casitone Fatty Acids Agar with Carbohydrates, Anaerobe Systems). Liquid cultures were established for each isolate through the inoculation of a single colony into 5-10 mL of media ...
-
No products found
because this supplier's products are not listed.
Kristoffer Krogerus, Nils Rettberg, Brian Gibson,
bioRxiv - Microbiology 2022
Quote:
... after which spores from the different parental strains were dissected and placed next to each other on YPD agar plates (1 % yeast extract, 2 % peptone, 2 % glucose, and 2 % agar) using a micromanipulator (Singer Instruments, UK). The plates were incubated at 25 °C for 3 days ...
-
No products found
because this supplier's products are not listed.
Yubao Fan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or 5% donkey serum (Abbkine, Wuhan, CN.) for 1 hour at room temperature ...
-
HDAC6is an enzyme that in humans is encoded by the HDAC6 gene. Histones play acritical role in...
Cat# HDAC6-402H,
25ug : USD $319
Ask
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and KAT 5 (KAT5-1350H; Creative Biomart) proteins following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lukas Spiller, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 nmol CpG (TIB MOLBIOL, Berlin, Germany), and an equal volume of Incomplete Freund’s adjuvant (IFA ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
MitoNeoD at 5 μM (563761, MedKoo Biosciences Inc.), RPA at 5 μM (ME043.1 ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Justin B. Hackett, et al.,
bioRxiv - Immunology 2022
Quote:
... and 100 μg anti CTLA-4 (clone 9D9, Leinco Technologies) in volume of 200 μg 1X PBS.
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
Cyclopropyl Bromide is a chemical reagent.
Cat# abx188668-25G,
25 g USD $232.0
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Diego A. Vargas-Blanco, et al.,
bioRxiv - Microbiology 2019
Quote:
... transferred to 2 mL disruption tubes (OPS Diagnostics 100 μm zirconium lysing matrix ...
-
No products found
because this supplier's products are not listed.
Nour Muinis Ramadan, et al.,
bioRxiv - Immunology 2020
Quote:
... supplemented with 5% of sheep blood (LAMPIRE biological laboratories, PA) and incubated anaerobically with CO2 anaerobic pack (AnaeroPack® System ...
-
No products found
because this supplier's products are not listed.
Wentao Yu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... An optical long-pass filter can be placed before the tube lens to further reduce the backscattered UV light. A custom-built 2-axis angle adjustable platform (Supplementary Fig. 2) under the vibratome (VF-700-0Z, Precisionary Instruments Inc.) ensures the focal plane of the objective lens is parallel with the surface of the sample sectioned by the vibratome ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Sifang Liao, Dick R. Nässel,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-tyrosine decarboxylase-2 (Tdc2; pab0822-P, Covalab, Cambridge ...
-
No products found
because this supplier's products are not listed.
Alexandra Tsirigotaki, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The hLeptin:hLEP-RCRH2 complex (6 mg/mL) was subjected to crystallization trials using a Mosquito liquid handling robot (TTP Labtech) in sitting drop format ...
-
No products found
because this supplier's products are not listed.
Anna Fagre, et al.,
bioRxiv - Microbiology 2020
Quote:
... BSL2 for trimming: Skulls were bisected (hemi skulls) and decalcified in semiconductor grade formic acid and EDTA (Calfor™, Cancer Diagnostics, USA) for 2-3 days ...
-
No products found
because this supplier's products are not listed.
Lucas Ferguson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... from 6 mL of polysome buffered 10% (w/v) D-sucrose and 6 mL of polysome buffered 50% D-sucrose solution using the Gradient Master (BioComp Instruments). Using a wide-bore pipette tip ...
-
No products found
because this supplier's products are not listed.
Adam T. Hilterbrand, et al.,
bioRxiv - Microbiology 2021
Quote:
... 250 ug/ml G418 and 5 ug/ml of puromycin (AG Scientific). CHO-nectin-1 cells were a gift from Richard Longnecker (Northwestern University) ...
-
No products found
because this supplier's products are not listed.
Gema M. Olivarria, et al.,
bioRxiv - Microbiology 2021
Quote:
... Cells were incubated overnight at 4°C in blocking solution with primary antibodies anti-MAP2 (EnCor Biotech. Cat:NC0388389) and anti-SARS-CoV-2 nucleocapsid (Sino Bio ...
-
No products found
because this supplier's products are not listed.
Simon P. Fraessle, et al.,
bioRxiv - Immunology 2022
Quote:
... 2×104 Target cells were seeded into 96 well E-Plate (ACEA Biosciences Inc.) and rested overnight ...
-
No products found
because this supplier's products are not listed.
Cato Prince, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 2 mM MgCl2 and 200 U of mSAN nuclease (Arcticzymes catalog #70950-150). Cell lysates were incubated at 37°C for 1 hour ...