-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Gwen R. Buel, et al.,
bioRxiv - Biophysics 2022
Quote:
... and incubated with 2 mM DSP (ChemScene CS-0068460 ...
-
No products found
because this supplier's products are not listed.
Hongbing She, et al.,
bioRxiv - Genomics 2020
Quote:
... The PCR was performed in a total reaction volume of 10 μL containing 5 μL 2×Taq Master Mix (CoWin Biosciences, China), 0.25 μL forward and reverse primer ...
-
No products found
because this supplier's products are not listed.
Joanna M. Cooper, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Alpha-2-macroglobulin was purchased from Athens Research and was activated by methylamine as described (Ashcom et al. ...
-
Cat# H2G029,
USD $125.0/pack
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Edward Sullivan, et al.,
bioRxiv - Microbiology 2021
Quote:
The BioSensor SARS-CoV-2 Ag Kit (Oxford Biosystems) was used in accordance with manufacturer’s instructions to process swab samples from hamsters ...
-
No products found
because this supplier's products are not listed.
Cian Schmitt-Ulms, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... and Cypridina Luciferase Assay reagent (Targeting Systems, VLAR-2) respectively ...
-
No products found
because this supplier's products are not listed.
Angela Lai, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Blood samples were collected at the inlet and outlet for measuring blood cell count (2 mL in K2EDTA) and aPTT/PT (3 mL in 1:9 citrate) using a clinical hematology analyzer (Diagnostica Stago Start 4, Siemens, Germany).12 If aPTT was outside the range of 20-50 seconds ...
-
No products found
because this supplier's products are not listed.
Abdugaffor Ablazov, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Approximately 20 mg of lyophilized rice samples were extracted twice with 2 mL of ethyl acetate containing 2 ng of D3-zaxinone (customized synthesis; Buchem B.V., Apeldoorn, The Netherlands). After that ...
-
No products found
because this supplier's products are not listed.
Clémence Boutry, et al.,
bioRxiv - Microbiology 2022
Quote:
... and on 2 June (only ‘Otava’, ‘Rajika’, ‘Rubinola’, and ‘Boskoop’). Trees with spore traps were excluded from receiving fungicide treatments in 2019 and 2020 ...
-
No products found
because this supplier's products are not listed.
Latha Muniappan, et al.,
bioRxiv - Pathology 2020
Quote:
Calpain-2 immunostaining was performed using a rabbit anti-human calpain-2 (10 µg/ml, catalog No. RP-3 Calpain-2; Triple Point biologics, Forest Grove, OR). CD68 immunostaining was performed using a rabbit anti-human CD68 antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
AL Seufert, et al.,
bioRxiv - Immunology 2022
Quote:
... 2% endotoxin- and fatty acid-free bovine serum albumin (BSA; Proliant Biologicals) and 10% M-CSF ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
A Prabhakar, et al.,
bioRxiv - Immunology 2021
Quote:
... 2-3 ml blood was collected in RNAgard blood tubes (Biomatrica, USA) and stored in −80°C until RNA precipitation ...
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
Erkko Ylösmäki, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... while BCG vaccine AJV (2-8×106 C.F.U/vial) from AJ Vaccines (Copenhagen, Denmark) was a kind gift from Professor Helen McShane (University of Oxford).
-
No products found
because this supplier's products are not listed.
Eileen M. Lynch, et al.,
bioRxiv - Pathology 2024
Quote:
... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Paraffin-embedded tissue sections (15 µm) of human articular cartilage from healthy (n=5) and OA-positive (n=6) anonymized donors were used (Articular Engineering, IL). Sections were immunolabeled with Piezo1-antibody (NBP1-78537 ...
-
No products found
because this supplier's products are not listed.
Yansheng Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 150 mM NaCl and 2 mM TCEP containing 6.5 mg/mL phage Pf1 (ASLA BIOTECH).
-
No products found
because this supplier's products are not listed.
Josua Oderbolz, et al.,
bioRxiv - Immunology 2021
Quote:
... M25 peptide (amino acid sequence: NHLYETPISATAMVI) was purchased from EMC microcollections (Tübingen, Germany) and 20 μg of the M25 peptide in 0.5% DMSO in 1x PBS solution were injected i.v ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Penghao Xu, et al.,
bioRxiv - Genomics 2023
Quote:
... neutralization using 2 M HCl and purification using HighPrep™ RNA Elite Clean-up System (MagBio Genomics) was performed ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Charles E. Mackay, et al.,
bioRxiv - Physiology 2021
Quote:
... Arterial segments 1-2 mm in length were cannulated at each end in a perfusion chamber (Living Systems Instrumentation) continuously perfused with PSS and maintained at 37°C ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
0.5 μg RNA was mixed with 4 μL 5X reaction buffer and 1 μL RTase (AzuraQuant cDNA synthesis kit, Azura Genomics cat: AZ1996). Reaction mix was incubated at 42°C for 30 min and denatured at 85°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Sylwia Machcinska, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Inc.)-conjugated cytokeratin 6 (CK6; NSJ Bioreagents, Cat # V2168) antibodies ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Neil J Rzechorzek, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEK293-F cells were grown in 400 mL batches in 2 L non-baffled Erlenmeyer flasks (TriForest Enterprises Inc, #FPC2000S) to a cell density of ∼1×106 cells/mL.
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shuyong Jia, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The classic LDFs of both control points (points 1 and 2) were recorded by a PeriFlux 5000 (Perimed AB, Stockholm, Sweden) system with a 64-Hz sampling rate ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... EPA 200.7 standard 6 purchased from High-Purity Standards was used for calibration ...
-
No products found
because this supplier's products are not listed.
Sebastian Müller, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and ECM 6-well plates (Celprogen, #E36102-29-6Well). Primary human T-cells were cultured in RPMI 1640 medium (Gibco ...
-
No products found
because this supplier's products are not listed.
Jordina Rincon-Torroella, et al.,
bioRxiv - Cancer Biology 2023
Quote:
MIA PaCa-2 or Panc 02.13 cells were transduced with a CMV-Firefly luciferase lentivirus carrying a puromycin-selectable marker (Cellomics Tech; Halethorpe, MD, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lucia Sedlackova, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM NR (ChromaDex), 10 μM olaparib (Cambridge Biosciences) ...
-
No products found
because this supplier's products are not listed.
Tyler P. Nicholas, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... or to silver nanoparticles (AgNP; 20 nm, gold-core, citrate-coated, at 1 mg/mL in 2 mM sodium citrate; nanoComposix, San Diego, CA, USA) for an acute exposure of 24 hours ...
-
No products found
because this supplier's products are not listed.
Alessandro Dema, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5% CO2 in a humidified tissue culture incubator and regularly tested for mycoplasma contamination (IDEXX BioResearch). H1299 cells and sublines were previously authenticated by STR profiling [7] ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... slides were incubated in 95% ethanol for 5 min and counterstained with Eosin (Poly Scientific S1761GL) for 1-3 min ...
-
No products found
because this supplier's products are not listed.
Christopher D. Go, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Beads were then washed with 150 μl of HPLC-grade water (Caledon Laboratory Chemicals CAT# 7732-18-5), centrifuged at 400 RCF for 1 min to pellet beads ...
-
No products found
because this supplier's products are not listed.
Wenfeng Zeng, et al.,
bioRxiv - Immunology 2022
Quote:
... 5×104 BMDCs were pulsed with 1 mg/ml endotoxin-free chicken egg ovalbumin (OVA, Hyglos GmbH, Germany) in the presence of 50 μg/ml MC38 TEVs or MLC-V ...
-
No products found
because this supplier's products are not listed.
Samuel Schmidt, et al.,
bioRxiv - Cell Biology 2020
Quote:
... incubated 24h at 4 °C) were used as substrates and prepared in Willco dishes (35 mm, Willco Wells B.V., HBSt-3522) as described46 ...
-
No products found
because this supplier's products are not listed.
Zhengtang Qi, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The membrane was blocked for 1 h at room temperature followed by incubation overnight at 4°C with primary antibodies including FAM132b (AVISCERA BIOSCIENCE), PI3K ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Lysate (600 μl) was incubated with 5 μg BAG-1L specific antibody rabbit monoclonal antibody (clone RM310; RevMAb Biosciences) at 4 °C for 16 hours to analyze the specificity of this antibody for its target ...
-
No products found
because this supplier's products are not listed.
Miriam R. Fein, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... frozen tissue sections were incubated with 1x blocking buffer (5% goat serum, 2.5% BSA in PBS) and Fc receptor blocker (Innovex Biosciences). Sections were incubated with rabbit anti-CD3 polyclonal antibody (1:500 dilution ...