-
No products found
because this supplier's products are not listed.
Daniela Araiza-Olivera, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... from MedChemExpress and diethyl pythiDC synthesized as described previously (21) or purchased from MedKoo Biosciences, Inc (#563602). ...
-
No products found
because this supplier's products are not listed.
Justin Riddle, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The P4 (4-pregenen-3,20-dione) enzyme immunoassay kit was provided by Salimetrics Inc (State College ...
-
No products found
because this supplier's products are not listed.
Yan Song, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and was administered by gavage through a 21-gauge round-tip feeding needle (Roboz Surgical Instrument, FN-7903). 90 min after gavage ...
-
No products found
because this supplier's products are not listed.
Kirill V. Sukhoverkov, Joshua S. Mylne,
bioRxiv - Plant Biology 2021
Quote:
... catalogue number S334, purity 98%) and clethodim (CAS 99129-21-2, catalogue number O401, purity 90%) were purchased from AK Scientific. Asulam (CAS 3337-71-1 ...
-
No products found
because this supplier's products are not listed.
Julia R. Port, et al.,
bioRxiv - Microbiology 2021
Quote:
The aerosol transmission system consisted of two 7” X 11” X 9” plastic hamster boxes (Lab Products, Inc.) connected with a 3” diameter tube (Supplementary Figure 1) ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Amelia S. Power, et al.,
bioRxiv - Physiology 2023
Quote:
... SERCA2a (1:5000, Badrilla A010-20), and CaMKIIδ (1:2000 ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Coelenterazine h (Prolume Ltd., 50909-86-9), GloSensorTM cAMP Assay Reagent (Promega ...
-
No products found
because this supplier's products are not listed.
Michael T. Patterson, et al.,
bioRxiv - Immunology 2023
Quote:
... DiI-oxLDL (Kalen Biomedical, Cat#: #770282-9) was added at 10 μg/ml for 4 hours at 37ºC ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
No products found
because this supplier's products are not listed.
Lunhua Liu, Kazuyo Takeda, Mustafa Akkoyunlu,
bioRxiv - Immunology 2020
Quote:
... phorbol 12-myristate 13-acetate (PMA)/ionomycin or autoantigens (1 μg/ml of DNA or SM (Immunovision)) ...
-
No products found
because this supplier's products are not listed.
Richard L Youngblood, et al.,
bioRxiv - Bioengineering 2019
Quote:
... placed on a 9-Position stir plate (Chemglass) set at rotation rate of 95 rpm in a 37°C incubator ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
Cat# G203,
USD $105.00/EA
Ask
Whee-Soo Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... silica-coated nanoparticles (1 mg) were then coated with m-dPEG12-TFP ester (9 mg, Quanta BioDesign, USA), Azido-dPEG12-TFP ester (1 mg ...
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... IMPACT Mouse FELASA and MKPV testing and was authenticated by CellCheck human 9 Test (9 Marker STR Profile and Inter-species Contamination Test) (IDEXX Analytics, Kornwestheim, Germany). H295R cells stably expressing a doxycycline inducible β-Catenin shRNA (pTer1 shRNA vector ...
-
No products found
because this supplier's products are not listed.
Athina Varveri, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... p62 MBL (rabbit; 1:500; MBL) and LC3 (mouse; 1:20; NanoTools) (in PSI Buffer ...
-
No products found
because this supplier's products are not listed.
Luisa F. Pallares, et al.,
bioRxiv - Genomics 2019
Quote:
... One 2.8mm stainless steel grinding bead (OPS diagnostics, #089-5000-11) and 100μl of lysis buffer (see Suppl ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Elizabeth R. Vanderwall, et al.,
bioRxiv - Immunology 2021
Quote:
... to measure HRV-16 replication in AEC cultures we used the Genesig® Human Rhinovirus Subtype 16 PCR Kit (Primerdesign®).
-
No products found
because this supplier's products are not listed.
Alessandra Boccaccini, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Protein extraction for PIF4 N3 (1:3000, Abiocode R2534-4) detection was performed according to Fiorucci et al. ...
-
No products found
because this supplier's products are not listed.
Sonja Prade, et al.,
bioRxiv - Immunology 2020
Quote:
EBV/LMP2-TCR transduced cells were re-stimulated with a titration of peptide-specific MHC Dextramer (0.8, 4, 20, 100pM, Immudex, Denmark) in the presence of 1μg/ml anti-CD28 (clone CD28.2 ...
-
No products found
because this supplier's products are not listed.
Noah J Harris, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Vesicles were extruded 11 times through a 150nm NanoSizer Liposome Extruder (T&T Scientific) and stored at −80°C.
-
No products found
because this supplier's products are not listed.
Avani Yeola, et al.,
bioRxiv - Cell Biology 2020
Quote:
... muscle of 3-4-month-old female SCID/Beige mice was injured by injection with 15 µL of 10 µM cardiotoxin (Latoxan). Confocal images of 3-4 serial sections/mouse were captured by Zen core/ AxioVision (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Avanti Gokhale, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3 1-minute washes) on a mini-100 orbital genie (Scientific Industries) at room temperature ...
-
No products found
because this supplier's products are not listed.
Steven A Kemp, et al.,
bioRxiv - Microbiology 2021
Quote:
... 9 DNA fragments with overlap sequences were amplified by PCR from a plasmid (phCMV1, Genlantis) encoding the full-length SARS-CoV-2 S gene (BetaCoV/Wuhan-Hu-1/2019 ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Recombinant human Aβ42 (20 μg/mL equivalent to 5 μM) from rPeptide (# A-1170-1) was incubated in 1× Tris-buffered Saline (TBS ...
-
Adenovirus
Cat# KC30996,
AdenoMag 200µL + Magnetic Plate MF96000, USD $654.00/KIT
Ask
Evangelos D. Karousis, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 20 ng/µl pSUPuro plasmid (1:1 mixture of pSUPuro UPF1 against two target sequences 52) in Opti-MEM containing 3% (v/v) Dogtor (OZ Biosciences) transfection reagent ...
-
No products found
because this supplier's products are not listed.
Evan M. Hess, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult WT and MSxc rats (N=10 and 9, respectively) underwent autoshaping in operant chambers (Campden Instruments) equipped with touch-sensitive display screens (Horner et al. ...
-
No products found
because this supplier's products are not listed.
Wei Wei, et al.,
bioRxiv - Biochemistry 2024
Quote:
... blood plasma was collected at 9 am and ELISA kits were used following manufacturer’s instructions (Leptin: Crystal Chem, 90030 ...
-
No products found
because this supplier's products are not listed.
Mengqi Luo, et al.,
bioRxiv - Biochemistry 2022
Quote:
... overnight at 4 °C and then HRP-conjugated secondary antibody (1:2000, ZEN BIO, China) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Viviane Kremling, et al.,
bioRxiv - Biochemistry 2024
Quote:
... His6-tagged nsp10-16 (expressed from HEK cells; commercially obtained from BPS Bioscience Catalog #100747) was labeled using the Monolith His-Tag Labeling Kit RED-Tris-NTA second generation (NanoTemper Technologies) ...
-
No products found
because this supplier's products are not listed.
Nancy Kendrick, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Fourteen human lung tumor and 11 control lung samples were purchased in two groups from a human biobank (ILS Bio, LLC, now BioIVT) Chesterfield ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Manon Laporte, et al.,
bioRxiv - Microbiology 2019
Quote:
... the plates were stained overnight at 4°C with anti-NP antibody diluted in 1% BSA (for IAV: Hytest #3IN5 at 1/2000 and for IBV ...
-
No products found
because this supplier's products are not listed.
Liz M. Florez, et al.,
bioRxiv - Plant Biology 2020
Quote:
... PCR amplification products were visualised following gel electrophoresis in a 2% (w/v) agarose gel in 1x Tris Acetate-EDTA (TAE) buffer with RedSafe™ (Intron Biotechnology, SEL, Korea), at the manufacturer’s recommended concentration ...
-
No products found
because this supplier's products are not listed.
Zara Y. Weinberg, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... with 20% human AB serum (Valley Biomedical, #HP1022) and 5% DMSO (Sigma-Aldrich #472301) ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus wood particles were decomposed with a mixture (20 mL) of acetic acid containing 1% peracetic acid using a microwave reactor (Biotage Initiator Plus) at 50 ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
F Quessy, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Brains sections were incubated overnight at 4°C with polyclonal antibodies against tyrosine hydroxylase (TH) 1:500 (Pel-Freez Biologicals, P60101), Phospho-p44/42 MAPK 1:250 (Erk1/2 ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Jordana Griffiths, et al.,
bioRxiv - Immunology 2020
Quote:
... Histogram overlays were produced using FCS Express (V.3) software (De Novo Software).
-
No products found
because this supplier's products are not listed.
Xiaojun Li, Angelika Doetzlhofer,
bioRxiv - Developmental Biology 2020
Quote:
... and expansion medium and plated into pre-warmed 4-well plates (CELLTREAT, no. 229103). For mice stage P2 ...
-
No products found
because this supplier's products are not listed.
Dinesh Devadoss, et al.,
bioRxiv - Physiology 2020
Quote:
... Culture supernatants were collected on day 3 and p24 antigen levels were determined using p24 ELISA (ZeptoMetrix Corp. Cat # 0801200) as per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
MULTI-ARRAY Standard 96-well plates (Meso Scale Diagnostics, Rockville, Maryland) were coated overnight at 4°C with K1 anti-dsRNA mouse monoclonal antibody (SCICONS, Budapest, Hungary). Plates were blocked using 5% MSD Blocker A (Meso Scale ...
-
No products found
because this supplier's products are not listed.
Ross D Overacker, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Inhibition of HIV-1 integrase was assessed using an HIV-1 integrase assay kit (XpressBio Life Science Products) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thorben Schramm, Vanessa Pahl, Hannes Link,
bioRxiv - Systems Biology 2023
Quote:
... covered with Breathe-Easy (Diversified Biotech BEM-1) adhesive membrane ...