-
No products found
because this supplier's products are not listed.
Sarah MacKinnon, et al.,
bioRxiv - Genetics 2022
Quote:
... 5’-fluoroorotic acid (5’FOA; Sigma) was used at a concentration of 1 g/L in PMG containing 45 mg/L uracil ...
-
No products found
because this supplier's products are not listed.
Michael Busche, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 5-fluoroorotic acid (Fisher Scientific), adenosine-5′-monophosphate disodium (Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Ser Sue Ng, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5% acetic acid (Merck), and dried using SpeedVac (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
Pete Heinzelman, Philip A. Romero,
bioRxiv - Genetics 2020
Quote:
... 5 g Casamino Acids (VWR), Citrate buffer (pH 4.5 ...
-
No products found
because this supplier's products are not listed.
Natalia Armas-Capote, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and 50 µM D-2-amino-5-phosphonovaleric acid (D-AP-5; Tocris) to isolate synaptic inhibitory transmission ...
-
No products found
because this supplier's products are not listed.
Claire E. Coupland, et al.,
bioRxiv - Biophysics 2021
Quote:
... and 5 mM valproic acid (Cayman Chemical). For biotinylated proteins ...
-
No products found
because this supplier's products are not listed.
Eri Hirata, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 5-Fluoroorotic acid (5-FOA; ZYMO RESEARCH F9003), or doxycycline (Sigma D9891) ...
-
No products found
because this supplier's products are not listed.
Dong Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... (2R)-2-amino-5-phosphonopentanoic acid (AP5; Abcam, 50 μM) and Picrotoxin (Abcam ...
-
No products found
because this supplier's products are not listed.
Huan Peng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 5-bromosalicylic acid (5-BAA) (>98.0%; TCI), isopropyl β-D-1- thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Pam S. Ellis, et al.,
bioRxiv - Cell Biology 2022
Quote:
Sense and anti-sense DIG-labelled RNA probes were synthesised from 5’ and 3’ regions of tert using DIG RNA Labelling Mix (Roche). A 562bp 3’ region of tert ...
-
No products found
because this supplier's products are not listed.
Maxime Deforet,
bioRxiv - Systems Biology 2023
Quote:
... 5 g/L casamino acids (Bacto, BD)) was solidified with agar (Bacto ...
-
No products found
because this supplier's products are not listed.
Sophie M. Travis, et al.,
bioRxiv - Cell Biology 2020
Quote:
... supplemented with 0.1% w/v 5-fluoroorotic acid (GoldBio) as indicated ...
-
No products found
because this supplier's products are not listed.
Alexander Munden, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 10 μg of nucleic acid was digested with 5 μL RNase H (NEB) at 37°C for 16 hours and 10 μg was mock digested without RNase H ...
-
No products found
because this supplier's products are not listed.
Han Na Suh, et al.,
bioRxiv - Cell Biology 2021
Quote:
Isolated Tert+ and Tert-cells (≤ 5 cells) were subjected to synthesize the complementary DNA (cDNA) using REPLI-g WTA Single Cell Kit (QIAGEN) and analyzed for gene expression by qRT-PCR ...
-
No products found
because this supplier's products are not listed.
Irene González-Domínguez, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 mL of Nonessential Amino Acid Solution (NEAA, Corning™ MEM, NY, USA), 3 μg/mL puromycin (Invivogen ...
-
No products found
because this supplier's products are not listed.
Hannah Guak, et al.,
bioRxiv - Immunology 2022
Quote:
... and 5 μM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
No products found
because this supplier's products are not listed.
Dimitri Dumontier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2-amino-5-phosphonovaleric acid (D-APV, Hellobio, Dunshaughlin, Republic of Ireland) at 50 µM was added to GCS and MRS to prevent glutamate excitotoxicity ...
-
No products found
because this supplier's products are not listed.
Lauren M. Ashwood, et al.,
bioRxiv - Genetics 2022
Quote:
... 5% glycerol pH 7.5 (TNG buffer) and incubated for 30 min with 5 mL Ni-nitrilotriacetic acid (Ni-NTA) Fast Flow resin (GE Healthcare, Uppsala, Sweden) in a gravity-fed column to capture the fusion protein via its affinity to Ni-NTA ...
-
No products found
because this supplier's products are not listed.
Amrita Sule, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... human TERT (LOX-TERT-iresTK; Addgene plasmid #12245), generously provided by Didier Trono ...
-
No products found
because this supplier's products are not listed.
João Leandro, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 4-oxo-5-hexenoic acid was obtained from Santa Cruz Biotechnology and succinylphosphonic acid was from MedChem Express ...
-
No products found
because this supplier's products are not listed.
Weijing Gu, et al.,
bioRxiv - Biochemistry 2021
Quote:
Micelles containing 5 mol% nitrobenzoxadiazole-phosphatidic acid (NBD-PA) (Avanti Polar Lipids, #9000341) and Triton X-100 (Research Products International Corp ...
-
No products found
because this supplier's products are not listed.
Gregor Diensthuber, et al.,
bioRxiv - Genomics 2023
Quote:
... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
No products found
because this supplier's products are not listed.
Dillon G. Patterson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5 ng/ml IL-5 (Biolegend; 581504), and 20 ng/ml IL-2 (Biolegend ...
-
No products found
because this supplier's products are not listed.
Guilherme S. Hentschke, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
No products found
because this supplier's products are not listed.
Wu Wei, et al.,
bioRxiv - Genomics 2019
Quote:
... and the 5’P of capped molecules was exposed by treatment with 5 units of Tobacco Acid Pyrophosphatase (Epicentre). RNA samples were ligated with the TIF-seq DNA/ RNA 5oligo cap using T4 RNA ligase 1 (NEB) ...
-
No products found
because this supplier's products are not listed.
Shawna K. Brookens, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 ng/mL IL-5 (Peprotech), and 50 nM 4-hydroxy-tamoxifen (4-OHT ...
-
No products found
because this supplier's products are not listed.
Hritika Sharma, Anjali Bose, Uma Kumar, Rahul Pal,
bioRxiv - Immunology 2020
Quote:
... LPS (5 µg/ml) or LPS (5 µg/ml) + concanavalin A (5 μg/ml; InvivoGen) were employed as control stimulants for splenocytes and isolated cells respectively.
-
No products found
because this supplier's products are not listed.
Anna Gritsenko, et al.,
bioRxiv - Immunology 2020
Quote:
... 5-Nitro-2-(3-phenylpropylamino)benzoic acid (NPPB, 0593) was sourced from Calbiochem.
-
No products found
because this supplier's products are not listed.
Johnathan Abou-Fadel, et al.,
bioRxiv - Systems Biology 2019
Quote:
... 5 µm (Phenomenex) column ...
-
No products found
because this supplier's products are not listed.
Kara Anazia, et al.,
bioRxiv - Biophysics 2024
Quote:
... 5% acrylamide (BIORAD), 0.1% SDS ...
-
No products found
because this supplier's products are not listed.
Zhigui Li, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and 5 μCi L-[U-14C]aspartic acid (0.1 mCi/mL, PerkinElmer) was added to each plate ...
-
No products found
because this supplier's products are not listed.
Magdalena Kasendra, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Ascorbic Acid and 5% fetal bovine serum (Lonza Cat. no. CC-3202). At this time the medium supplying the epithelial channel was switched to differentiation medium ...
-
No products found
because this supplier's products are not listed.
Fiorella Carla Grandi, et al.,
bioRxiv - Genetics 2024
Quote:
... for 1 hour and then in running tap water (5 minutes) and acetic acid (0,5%, 5 minutes) followed by dehydration and mounting with VectaMount™ Mounting Medium (Vector Laboratories). Images were obtained using a digital microscope (Keyence ...
-
No products found
because this supplier's products are not listed.
Thomas C. Harper, et al.,
bioRxiv - Immunology 2023
Quote:
... and 50 μg/ml L-Ascorbic Acid)) supplemented with Growth Factor Cocktail (5 ng/ml BMP4, 5 ng/ml bFGF, 10 ng/ml IL-6 (R&D systems, 206-IL), 10 ng/ml Flt3L (PeproTech ...
-
No products found
because this supplier's products are not listed.
Sabrina Meindlhumer, et al.,
bioRxiv - Biophysics 2022
Quote:
... as well as 5 mM Phosphoenolpyruvic acid (Alfa Aesar) and 0.01 mg/mL pyruvate kinase for ATP regeneration ...
-
No products found
because this supplier's products are not listed.
Maria G. Noval, et al.,
bioRxiv - Microbiology 2023
Quote:
... for 5 min and differentiated in 1% acetic acid (Polysciences, 25088f) for 1 min before dehydration and mounting with permount (Fisher ...
-
No products found
because this supplier's products are not listed.
Maria L. White, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5 (BioTek). OD600nm readings were taken every hour and growth curves were plotted using GraphPad Prism 9.
-
No products found
because this supplier's products are not listed.
Su-Juan Liu, et al.,
bioRxiv - Microbiology 2023
Quote:
The short labelled RNAs 5’ p-LU13-FAM (5’ p-GAGACAGUAUUUG-FAM) and 5’ OH-LU13-FAM (5’ OH-GAGACAGUAUUUG-FAM) were chemically synthesized by Genscript Biotech Corporation ...
-
No products found
because this supplier's products are not listed.
Jin Luo, et al.,
bioRxiv - Microbiology 2020
Quote:
... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
No products found
because this supplier's products are not listed.
Blake A. Caldwell, Yajun Wu, Jing Wang, Liwu Li,
bioRxiv - Immunology 2023
Quote:
... For 5-azacytidine (5-aza; Stem Cell Technologies) and trehalose 6,6’-dimycolate (TDM ...
-
No products found
because this supplier's products are not listed.
Gabriel S. Jensen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stellaris 5 (Leica), or LSM 900 (Zeiss ...
-
No products found
because this supplier's products are not listed.
Hattie Chung, et al.,
bioRxiv - Genomics 2021
Quote:
... 5% normal donkey serum and 5% normal goat serum (Jackson Immunoresearch) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Ons Mamai, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-pSMAD1/5 (Cell Signaling), anti-SMAD4 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Weston Kightlinger, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... The completed strain was then used to inoculate a 5 ml overnight culture in LB media containing appropriate antibiotics which was then subcultured at OD600 = 0.08 into 5 ml of fresh LB media supplemented with 5 mM N-Acetylneuraminic acid (sialic acid) purchased from Carbosynth and adjusted to pH = 6.0 using NaOH and HCl ...
-
No products found
because this supplier's products are not listed.
Dixcy Jaba Sheeba John Mary, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... 5-azacytidine (5-aza) was procured from MP Biomedicals (Solon, USA). 17β-estradiol (E2 ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Denzil Furtado, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or 5-methoxyuridine 5’-triphosphate (5moUTP, APExBIO), and cytidine 5’-triphosphate (CTP ...
-
No products found
because this supplier's products are not listed.
Christian Franke, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 5 % CO2 (Eppendorf). Jurkat CD4-KO cells were derived from wild-type Jurkat T cells (clone E6 ...
-
5-Methoxysalicylic acid is a chemical compound belongs to the class of organic compounds known...
Cat# S6319, SKU# S6319-25mg,
25mg, $97.00
Ask
Marc A. Vittoria, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5-10 µM (Selleck Chemicals); RACi ...