-
No products found
because this supplier's products are not listed.
Adrian Brückner, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 2-Methoxy-3-methyl-1,4-BQ was synthesized as follows: 2 mmol 2-Methoxy-3-methyl-1,4-hydroquinone (Sigma Aldrich) and 2 mmol NaIO4 were mixed in a 50 ml round-bottom flask and 10 ml CH2Cl2 and 5 ml of water were then added ...
-
No products found
because this supplier's products are not listed.
Vipin Rawat, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... then adding 15 µL of methoxy amine in pyridine (MOX) (Thermo Fisher) and incubating at 40°C for 90 min ...
-
No products found
because this supplier's products are not listed.
Jaakko Haverinen, Minna Hassinen, Matti Vornanen,
bioRxiv - Physiology 2021
Quote:
... L-364,373 (R-L3 or 5-(2-Fluorophenyl)-1,3-dihydro-3-(1H-indol-3-ylmethyl)-1-methyl-2H-1,4-benzodiazepin-2-one) (Tocris Cookson; Bristol, UK) and mefenamic (dimethylphenylaminobenzoic ...
-
No products found
because this supplier's products are not listed.
Jasmine Phénix, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and pyridine (Merck, Germany, 9:3:1) in a GC vial for GC–mass selective detector non-cholesterol and oxysterol analysis ...
-
No products found
because this supplier's products are not listed.
Chisato M. Yamazaki, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and 1-methoxy-5-methylphenazinium methylsulfate (1-methoxy PMS, 100 μM, Cayman Chemical) was added to each well ...
-
No products found
because this supplier's products are not listed.
Michelle Y Meng, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... 3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP) hydrochloride was purchased from Abcam, and RO4 was a gift from Dr Wendy Winchester.
-
No products found
because this supplier's products are not listed.
Lisa Weixler, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... anti-tubulin 1:5000 (B-5-1-2 Santa Cruz). For slot blotting ...
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Tina Wiegand, et al.,
bioRxiv - Biophysics 2024
Quote:
... 0.1 % 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethyleneglycol)-5000] (ammonium salt) (PEG5000 PE) and 0.01 %DiL (all Avanti Polar Lipids). Lipids were dissolved in chloroform ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Maxence Noel, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Membranes were incubated with 2 µg/mL biotinylated lectins from Vector Labs (VVA B-1235-2, PNA B-1075-5) in conditions as previously described ...
-
No products found
because this supplier's products are not listed.
Ffion R Hammond, et al.,
bioRxiv - Immunology 2023
Quote:
... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Aishwarya Rengarajan, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Collagenase B solution 2 mg ml−1 B (Roche, Indiana) was used for HUVEC isolation (detailed protocol in 10) ...
-
No products found
because this supplier's products are not listed.
Jason C. Collins, et al.,
bioRxiv - Biochemistry 2023
Quote:
... blocked in 2% BSA for 1h and stained with primary anti-UBA1a/b antibodies (Cell Signaling, 4891S, 1:500) for 1h ...
-
No products found
because this supplier's products are not listed.
Kristel Martinez Lagunas, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Hygromycin-B (Invivogen, ant-hg-1/5), Neomycin (Invivogen ...
-
No products found
because this supplier's products are not listed.
Aleksej Drino, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Biotinylated small RNAs were separated from HPDP-biotin and pyridine-2-thione using spin columns (BioRad) in ultra-pure water.
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Teresa Neuwirth, et al.,
bioRxiv - Immunology 2024
Quote:
... Each patient was also stained with one of TotalSeq™-C0251/2/3/4 Antibody (Biolegend, Cat: 394661/3/5/7, 1:100) for sample multiplexing ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Aram Shaldzhyan, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Mouse IL-28 A/B (IFN-lambda 2/3) Du-oSet ELISA (DY1789B, R&D Systems), was used to assess cross-reactivity.
-
No products found
because this supplier's products are not listed.
Sapir Herchcovici Levi, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (PeproTech, SM-2520691-B) and 0.2 µM PD0325901 (PeproTech ...
-
No products found
because this supplier's products are not listed.
Pau Perez Escriva, Tobias Fuhrer, Uwe Sauer,
bioRxiv - Microbiology 2021
Quote:
... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
No products found
because this supplier's products are not listed.
Joshua D. Kerkaert, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 300μL of XTT solution was added to each well (0.5mg/mL XTT [2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] (VWR) with 25μM menadione in PBS) ...
-
No products found
because this supplier's products are not listed.
Ke Xu, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... rabbit anti-B-cell lymphoma-2 (BCL-2) polyclonal antibody (1:1,000 dilution, 26593-1-AP, Proteintech, Rosemont, IL, USA) and mouse anti-GAPDH monoclonal antibody (1:10,000 dilution ...
-
No products found
because this supplier's products are not listed.
Martin H. Berryer, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 5 mL N2 supplement B (StemCell Technologies, 07156)] supplemented with SB431542 (10 µM ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Jorge Vera-Otarola, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1% amphotericin B (Ampho B, #30-003-CF, Corning), 1% penicillin-streptomycin (P/S ...
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Xuefeng Ren, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3 mM b-mercaptoethanol (BME) and then loaded onto a HiTrap SP HP 5 ml column (GE healthcare, Piscataway, NJ). Elution from the SP column was performed with a 70 ml linear gradient from 0–500 mM NaCl in SP buffer A ...
-
No products found
because this supplier's products are not listed.
Christopher D. Greer, et al.,
bioRxiv - Immunology 2021
Quote:
... or 1 ug/ml SARS-CoV-2 Spike-RBD (Sino Biological, 40592-V08B-B) in PBS ...
-
No products found
because this supplier's products are not listed.
Maria-Graciela Delgado, et al.,
bioRxiv - Cell Biology 2024
Quote:
... post fixed for 1h with 2% buffered osmium tetroxide (Electron Microscopy Sciences, cat. #19150), dehydrated in a graded series of ethanol solution ...
-
No products found
because this supplier's products are not listed.
Buse Baran, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Guide RNA sequences “5-CGUGUCACGACGGAGUGGAU-3” and “5-AUGUUGUAUGUGCCUAUACG-3” were synthesized by GenScript by adding the Cas12a scaffold sequence (5-UAAUUUCUACUCUUGUAGAU-3 ...
-
No products found
because this supplier's products are not listed.
Calina Glynn, et al.,
bioRxiv - Biochemistry 2024
Quote:
3 mm type B gold-plated copper high pressure freezing carriers (Leica Microsystems) were prepared as previously described19 ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Haribaskar Ramachandran, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were blocked with 3%BSA diluted in PBS for 1h at RT and then incubated with anti-CD-19-PE antibody (1:50) in 3% BSA-PBS (Miltenyi Biotec) for 1h at RT ...
-
No products found
because this supplier's products are not listed.
Paolo Mesén-Ramírez, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 200 mM hypoxanthine and 2-5% fresh human RBCs (B+; provided by Universität Klinikum Eppendorf, Hamburg). Cultures were maintained at 37 °C ...
-
No products found
because this supplier's products are not listed.
Miao-Hsi Hsieh, et al.,
bioRxiv - Microbiology 2020
Quote:
... coverslips were blocked with 2% w/v BSA for 1h and incubated with ACE2 antibody [SN0754] (1:250) (GeneTex, GTX01160), followed by Goat anti-rabbit IgG (H+L ...
-
No products found
because this supplier's products are not listed.
Karthikeyan Thirugnanam, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Smad 2/3 (Novus Biologicals, Cat# AF3797, 1:200 dilution), GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Vignesh Venkatakrishnan, et al.,
bioRxiv - Biochemistry 2020
Quote:
... disrupted with a tip sonicator at 1/3 power (8 MHz) for 3 × 30 seconds on ice and fractionated by ultracentrifugation (100’000 x g, 1H, Beckman TLA 120.2 rotor). The luminal fraction was concentrated to around 50 µL on a 3 kDa MWCO Amicon Ultra 0.5 mL centrifugal filter while membrane pellets were dissolved in 50 µL TBS with 2% SDS ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Aaron T. Crain, et al.,
bioRxiv - Genomics 2024
Quote:
... Membranes were blocked in 5% milk in TBS- Tween for 1h prior to incubation with α-GFP (1:1000, Rockland) or α-Set8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Yili Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Intracellular recordings from MNs were made with 10-20 MΩ sharp electrodes filled with 3 M potassium acetate connected to an Axoclamp 2-B amplifier (Molecular Devices). Data acquisition and analyses of resting potential ...
-
No products found
because this supplier's products are not listed.
Or-Yam Revach, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Luminescence was read every 10 min for 1h using Cytation 5 microplate reader and Gen5 software (BioTek). Relative NAD(H ...
-
No products found
because this supplier's products are not listed.
Jongbeom Park, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... for 1h at 37°C and then purified with the Zymo DNA Clean and Concentrator-5 kit (Zymo). Illumina sequencing adaptors and barcodes were added to the DNA fragments ...
-
No products found
because this supplier's products are not listed.
Alice L. Herneisen, et al.,
bioRxiv - Microbiology 2024
Quote:
... The membrane was incubated in secondary antibody solution (1:10,000 Goat anti-Mouse IgG IRDye 800 or 680) in 5% milk/PBS for 1h at room temperature and was visualized by LI-COR Odyssey CLx ...
-
No products found
because this supplier's products are not listed.
Stephen Abini-Agbomson, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Cells were incubated in blocking solution (3% BSA in TBS-Tween 0.1%) for 1h with primary antibody (anti-53BP1, Rabbit polyclonal, Bethyl #A300-272A) diluted in blocking solution overnight at 4°C ...