-
No products found
because this supplier's products are not listed.
Caitlin L. Maikawa, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 4-((((2-carboxyethyl)thio)carbonothioyl)thio)-4-cyanopentanoic acid (BM1433; Boron Molecular, >95%) were used as received ...
-
No products found
because this supplier's products are not listed.
Athanasios Papadas, et al.,
bioRxiv - Immunology 2021
Quote:
Paraffin-embedded murine tumor sections and unstained 4-5 μm-thick human lung carcinoma TMA (US Biomax Inc., BC041115e) sections were deparaffinized and rehydrated using standard methods ...
-
No products found
because this supplier's products are not listed.
Kevin R. Theis, et al.,
bioRxiv - Microbiology 2019
Quote:
... placed into a sterilized Wheaton dounce reservoir (2 ml or 5 ml; DWK Life Sciences, Millville, NJ) containing 1 ml of sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Gabriel Brawerman, et al.,
bioRxiv - Cell Biology 2021
Quote:
... aliquots of the low and high glucose supernatants and the insulin content extracts were collected and spun at 3000g for 5 minutes at 4°C and stored at −20°C or used immediately for mouse or human insulin ELISAs (Mercodia) with appropriate dilutions (1:10-1:50 for supernatants ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The established stable cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Nacalai Tesque) supplemented with 4∼5% fetal calf serum (FCS; Thermo Fisher Scientific, or Nichirei Biosciences Inc) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
Jennifer Eng, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Formalin-fixed paraffin-embedded (FFPE) human tissues were sectioned at 4-5 microns and mounted on positively charged slides (Tanner Adhesive Slides, Mercedes Medical, TNR WHT45AD). The slides were baked overnight at 55 °C (Robbin Scientific ...
-
No products found
because this supplier's products are not listed.
Jan D. Beck, et al.,
bioRxiv - Immunology 2023
Quote:
... and 60 mg/kg 5-fluorouracil (5-FU) (Medac) in 0.9% NaCl (Braun ...
-
No products found
because this supplier's products are not listed.
Ruicai Long, et al.,
bioRxiv - Plant Biology 2021
Quote:
A Chinese native alfalfa cultivar Zhongmu-4 (Medicago sativa L. cv. Zhongmu-4), one of the most planted alfalfa in North China for its high yield ...
-
No products found
because this supplier's products are not listed.
Mohd Sariq, Omkar, Geetanjali Mishra,
bioRxiv - Zoology 2023
Quote:
... Adults of both species were paired and placed in beakers separately under laboratory conditions (27 ± 2°C temperature; 65 ± 5% relative humidity; 14L:10D photoperiod in Biochemical Oxygen Demand Incubators; Yorco Super Deluxe, YSI-440 New Delhi, India) and were provided with ad libitum supply of aphids ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
David T. Han, Weichen Zhao, Wade H. Powell,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... 1999) and 1 GRE (5’AGAACAGT3’ > 5’TAGCATCT3’) were generated by site-directed mutagenesis (Epoch Life Sciences). Transactivation Assays ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... three sections for each brain electroporated at E14.5 with pUB6-TOM and pSilencer-U6-scram (number of brains, n = 4) or pSilencer-U6-miR-137 (number of brains, n = 4) and injected with retrobeads (Lumafluor) at P9 ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
No products found
because this supplier's products are not listed.
Yubao Fan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or 5% donkey serum (Abbkine, Wuhan, CN.) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Huaqi Su, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The pooled HD samples were made up to 8 mL with PBS and equally divided into 16 aliquots of 500 µL (4 aliquots for each of the 4 SEC column types) and loaded onto IZON qEVoriginal™ 35nm or 70nm (IZON Science), or home-made Sepharose™ CL-4B or CL-6B (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Wadie D. Mahauad-Fernandez, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 1x premix 4 to 7.3 ampholyte (Protein Simple) were loaded onto the capillaries ...
-
No products found
because this supplier's products are not listed.
King L. Hung, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... were diluted 1:4 in hybridization buffer (Empire Genomics) and added to the sample with the addition of a slide ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
José Antonio Valer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... BYL719 at 2 or 10 μM (Chemietek) and 2 nM BMP6 (R&D ...
-
No products found
because this supplier's products are not listed.
Yeranuhi Hovhannisyan, et al.,
bioRxiv - Pathology 2023
Quote:
... and CW30318 (Control 2, Fuji Cellular Dynamics) derived from healthy individuals without any cardiac pathology ...
-
No products found
because this supplier's products are not listed.
Robert G. Stewart, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 5 mm German glass coverslips (Bellco Glass, 1943-00005), which had previously been washed in 70% ethanol and sterilized with ultraviolet light ...
-
No products found
because this supplier's products are not listed.
Jasper T. Maniates-Selvin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and diamond knife (4 mm, 35° Ultra or Ultra-Maxi, Diatome) were used to cut ultra-thin serial sections (∼45 nm ...
-
No products found
because this supplier's products are not listed.
Petr Šulc, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 5 µg of anti-dsRNA mAb (J2) (SCICONS, cat# 10010500) were bound to 30 µl of washed beads overnight at 4° C on a rotating wheel ...
-
No products found
because this supplier's products are not listed.
Momei Zhou, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were fixed with 4% PFA at 4 days post-infection and processed with Immunohistochemistry (IHC) using mouse monoclonal anti-VZV antibody (Meridian Life Sciences C05108MA, 1:2000 diluted in PBS), followed by incubation with biotinylated anti-mouse IgG (Vector Laboratories #BA-9200) ...
-
No products found
because this supplier's products are not listed.
Caroline M Weight, et al.,
bioRxiv - Immunology 2019
Quote:
... or pneumococcal antisera Type 4 (for TIGR4 and dPly detection, SSI Diagnostica) to detect pneumococci ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
No products found
because this supplier's products are not listed.
Ruth I. Connor, et al.,
bioRxiv - Immunology 2023
Quote:
... Omicron BA.1 or Omicron BA.2 (Immune Technology) diluted to 5 μg/ml in 1X PBS and incubated overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Xiaona Chen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... gastrocnemius and quadriceps muscles were injected with CTX (Latoxan; 10−5 M). At the indicated time points (3- and 7-day post injury) ...
-
No products found
because this supplier's products are not listed.
Hanna G. Budayeva, et al.,
bioRxiv - Biochemistry 2023
Quote:
... peptides were cleaned up using a 5 µl C18 Phytip (Biotage, Inc) and injected for LC-MS/MS acquisition.
-
No products found
because this supplier's products are not listed.
Qian Li, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5 mM MgCl2) was prepared on a Gradient Station platform (Biocomp Instruments). 450 µl of the lysate was carefully layered on top of the sucrose gradient and centrifuged at 35000 rpm (210000g ...
-
No products found
because this supplier's products are not listed.
Natalie Burchat, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Plasma glucagon-like peptide-1 and -2 (GLP-1 and GLP-2) were measured by ELISA (RayBiotech, Peachtree Corners, Georgia and Crystal Chem, Elk Grove Village, IL, respectively).
-
No products found
because this supplier's products are not listed.
Shuo Yang, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-SARS-CoV-2-ORF3a (1:250; 101AP, FabGennix International Inc), anti-Actin (1:500 ...
-
No products found
because this supplier's products are not listed.
Longhuan Ma, et al.,
bioRxiv - Immunology 2024
Quote:
... then individual colonies were grown in 5 ml of BHI media (Anaerobe Systems) under anaerobic conditions for 16 h ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Resin was treated with 25mU of Arthrobacter ureafaciens sialidase (EY laboratory, EC-32118-5) at room temperature for 1 hr and then washed with 10 ml of 10 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Jie Su, Naoko Toyofuku, Takuro Nakagawa,
bioRxiv - Genomics 2021
Quote:
... After adding 5 to 10 µl Zymolyase 20T (Seikagaku, Tokyo, Japan, 25 mg/ml) and 5 to 10 µl lyzing enzyme (Sigma ...
-
No products found
because this supplier's products are not listed.
Tábata Apablaza, et al.,
bioRxiv - Physiology 2024
Quote:
... Paraffin sections (5 μm) were treated with 1X EDTA buffer pH 8.0 (Diagnostic Biosystem), blocked with 2.5% normal goat serum (Vector Laboratories cat# S-1012) ...
-
No products found
because this supplier's products are not listed.
Ting Pan, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Seeds were surface-sterilized and sowed on MS/2 medium (PhytoTechnology laboratories) (1% sucrose pH 5.7 ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Thibault Courtellemont, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 0.5 OD600 units were transferred into 5 mL of SC-arginine/-lysine (Sunrise Science Products) supplemented with 0.43 mM arginine and lysine ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Microdialysis probes (2 mm; 38 kDa molecular weight cut off; BR-style; BASi) were inserted into the guide cannula ...
-
No products found
because this supplier's products are not listed.
Sebastian Fiedler, et al.,
bioRxiv - Biochemistry 2020
Quote:
Anti-SARS-CoV-2 seropositive human serum samples (convalescent) were obtained from BioIVT. BioIVT sought informed consent from each subject ...
-
No products found
because this supplier's products are not listed.
Brady G. Anderson, et al.,
bioRxiv - Systems Biology 2023
Quote:
Fecal samples were weighed into pre-tared 2 mL Precellys® (Bertin Corp.) compatible vials ...
-
No products found
because this supplier's products are not listed.
Gema M. Olivarria, et al.,
bioRxiv - Microbiology 2021
Quote:
... Cells were incubated overnight at 4°C in blocking solution with primary antibodies anti-MAP2 (EnCor Biotech. Cat:NC0388389) and anti-SARS-CoV-2 nucleocapsid (Sino Bio ...
-
No products found
because this supplier's products are not listed.
Jordan A Bairos, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Low-density lipoprotein (LDL) and acetylated LDL (acLDL) was from Kalen Biomedical (catalog #770200-8 and #770201-4). Hoechst 33342 (catalog #62249) ...
-
No products found
because this supplier's products are not listed.
Thomas W Jackson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 5 μl of Proteinase K (20 mg/ml; Viagen Biotech, Los Angeles, CA; Cat: 501-PK) were added to the biopsy sample ...
-
No products found
because this supplier's products are not listed.
Heather A. Danhof, et al.,
bioRxiv - Microbiology 2023
Quote:
... and the slides were incubated at 4°C in a humid slide staining tray (Newcomer Supply, Middleton, WI, USA) overnight ...