-
No products found
because this supplier's products are not listed.
Bastian Ramms, et al.,
bioRxiv - Physiology 2021
Quote:
Plasma insulin levels were measured after 5 h of fasting or before and 10 min after a glucose gavage (2 mg/g body weight) of fasted (5 h) mice via the mouse ultrasensitive or mouse insulin ELISA kit (Alpco).
-
No products found
because this supplier's products are not listed.
Kyoung-Dong Kim, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 μl of 5× TuneUp solution (NanoHelix, Korea), 1 μl of Taq-plus polymerase (NanoHelix ...
-
Cat# N5C,
10/pack, USD $39.00/Pack
Ask
Suzanne M Johnson, et al.,
bioRxiv - Cell Biology 2020
Quote:
... was centrifuged in 2 tubes to remove cells (300 × g 5 minutes, × 2) and filtered using a double layered 5µm pore nylon Sieve (Fisher Scientific: BioDesign cat 12994257). The supernatant was collected and centrifuged at 2000 × g for 30 minutes and prepared for ISX analysis ...
-
No products found
because this supplier's products are not listed.
Grace Ying Shyen Goh, et al.,
bioRxiv - Genetics 2022
Quote:
... and PUFAs (mix of fatty acid sodium salts: 150 μM C18:2, S-1127; 150 μM C20:5, S-1144, Nu-Chek Prep). E ...
-
No products found
because this supplier's products are not listed.
Mohd Sariq, Omkar, Geetanjali Mishra,
bioRxiv - Zoology 2023
Quote:
... Adults of both species were paired and placed in beakers separately under laboratory conditions (27 ± 2°C temperature; 65 ± 5% relative humidity; 14L:10D photoperiod in Biochemical Oxygen Demand Incubators; Yorco Super Deluxe, YSI-440 New Delhi, India) and were provided with ad libitum supply of aphids ...
-
No products found
because this supplier's products are not listed.
Deborah L. Gater, et al.,
bioRxiv - Biophysics 2022
Quote:
... Vitamin D binding protein (DBP) was purchased from Athens Research and Vitamin D Binding protein (VDR ...
-
No products found
because this supplier's products are not listed.
Yen-Chun Ho, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (3Helix; R-CHP; 5 μM).
-
No products found
because this supplier's products are not listed.
Prashant P. Damke, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 5% FBS (Cell Biologics H6621) in collagen-coated cell culture flasks at 5% CO2 and 37°C ...
-
No products found
because this supplier's products are not listed.
Amitabh Das, et al.,
bioRxiv - Genetics 2023
Quote:
... a 5-0 silk suture (Roboz) was tied around the maxillary left second molar and left in place for 5 days(34) ...
-
No products found
because this supplier's products are not listed.
Alexander C. Whitebirch, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Diazepam (5 mg/kg, i.p.; McKesson #636203) was administered 1 hr after SE onset to curtail seizures ...
-
No products found
because this supplier's products are not listed.
Yubao Fan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or 5% donkey serum (Abbkine, Wuhan, CN.) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Benjamin T. Throesch, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 mM MgCl2-6H2O (Honeywell Research Chemicals), 1 mM CaCl2 (Honeywell Research Chemicals) ...
-
No products found
because this supplier's products are not listed.
Hosouk Joung, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... mouse skeletal muscle developmental western blots (MW-102-d, Zyagen, San Diego, CA, USA) and mouse normal tissue blot II (1562 ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Zongyu Li, et al.,
bioRxiv - Physiology 2023
Quote:
... and VEGF concentrations were measured by ELISA (R&D Systems, Mercodia, Abcam, and Sigma, respectively), and total plasma bile acids using a colorimetric assay (Abcam) ...
-
No products found
because this supplier's products are not listed.
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and 5% BriClone Hybridoma Cloning Medium (QED Bioscience). One hundred units/ml penicillin ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-SERT (ST51-2; Mab Technologies), rabbit anti-HA (C29F4 ...
-
No products found
because this supplier's products are not listed.
Andrea M. Chambers, et al.,
bioRxiv - Immunology 2021
Quote:
... 500 IU/mL IL-2 (Akron Biotech), 50 ng/mL hIL-21 (Gold Bio) ...
-
No products found
because this supplier's products are not listed.
Javier Martínez Pacheco, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Rabbit AtTOR polyclonal antibodies (Abiocode, R2854-2), rabbit polyclonal S6K1/2 antibodies (Agrisera ...
-
No products found
because this supplier's products are not listed.
José Antonio Valer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... BYL719 at 2 or 10 μM (Chemietek) and 2 nM BMP6 (R&D ...
-
No products found
because this supplier's products are not listed.
Yeranuhi Hovhannisyan, et al.,
bioRxiv - Pathology 2023
Quote:
... and CW30318 (Control 2, Fuji Cellular Dynamics) derived from healthy individuals without any cardiac pathology ...
-
No products found
because this supplier's products are not listed.
Jaylissa Torres Robles, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Samples were boiled at 95ºC for 5 min and fractionated on 5% SDS-polyacrylamide gels with 25 nM Phos-tag reagent (Nard Institute AAL-107) and 50 μM MnCl2 as reported previously78 or by standard SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Emily B. Cohen, Renee C. Geck, Alex Toker,
bioRxiv - Cancer Biology 2020
Quote:
... containing 5% w/v nonfat dry milk (Andwin Scientific) for 1 hr and then incubated with primary antibody diluted in TBST with 5% bovine serum albumin (BSA ...
-
No products found
because this supplier's products are not listed.
Robert G. Stewart, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 5 mm German glass coverslips (Bellco Glass, 1943-00005), which had previously been washed in 70% ethanol and sterilized with ultraviolet light ...
-
No products found
because this supplier's products are not listed.
Diego A. Vargas-Blanco, et al.,
bioRxiv - Microbiology 2019
Quote:
... transferred to 2 mL disruption tubes (OPS Diagnostics 100 μm zirconium lysing matrix ...
-
No products found
because this supplier's products are not listed.
Mari Suzuki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Clone C92F3-5 (StressMarq Biosciences Cat# SMC-100, 1:2000); anti-HSP90 ...
-
No products found
because this supplier's products are not listed.
Petr Šulc, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 5 µg of anti-dsRNA mAb (J2) (SCICONS, cat# 10010500) were bound to 30 µl of washed beads overnight at 4° C on a rotating wheel ...
-
No products found
because this supplier's products are not listed.
Bo Wei, et al.,
bioRxiv - Neuroscience 2023
Quote:
... D/V: 4.3∼4.7 mm) of retrograde fluorescence microbeads (Lumafluor Inc., Red Retrobeads TM IX; 100∼150 nl).
-
No products found
because this supplier's products are not listed.
B. H. Abuaita, et al.,
bioRxiv - Immunology 2019
Quote:
... CASPASE-2 FAM-VDVAD-FMK FLICA substrate (ImmunoChemistry Technologies) for 1h at 37°C or 2 μM CellEvant CASPASE-3/7 Green detection reagent (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Chengfeng Xiao, Shuang Qiu,
bioRxiv - Genetics 2020
Quote:
... separated in 2 % gel of agarose (A87-500G, FroggaBio), and visualized with AlphaImager 2200 Gel Documentation and Image Analysis System (Alpha Innotech).
-
No products found
because this supplier's products are not listed.
Sifang Liao, Dick R. Nässel,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-tyrosine decarboxylase-2 (Tdc2; pab0822-P, Covalab, Cambridge ...
-
No products found
because this supplier's products are not listed.
Christophe Michel Raynaud, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... EZ Standard Pack 2 (Protein simple, #PS- ST02EZ-8) and Anti-mouse detection module (Protein simple DM-002) ...
-
No products found
because this supplier's products are not listed.
Toshinori Hyodo, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Both cells were propagated in Dulbecco’s Modified Eagle’s Medium (D-MEM; Fujifilm, Osaka, Japan) supplemented with 10 % Fetal Bovine Serum (FBS; Nichirei Bioscience, Tokyo, Japan) and 1 % Penicillin-Streptomycin (Fujifilm).
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... followed by 5 days of decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Resin was treated with 25mU of Arthrobacter ureafaciens sialidase (EY laboratory, EC-32118-5) at room temperature for 1 hr and then washed with 10 ml of 10 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Tábata Apablaza, et al.,
bioRxiv - Physiology 2024
Quote:
... Paraffin sections (5 μm) were treated with 1X EDTA buffer pH 8.0 (Diagnostic Biosystem), blocked with 2.5% normal goat serum (Vector Laboratories cat# S-1012) ...
-
No products found
because this supplier's products are not listed.
Ting Pan, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Seeds were surface-sterilized and sowed on MS/2 medium (PhytoTechnology laboratories) (1% sucrose pH 5.7 ...
-
No products found
because this supplier's products are not listed.
Jonna Heldrich, et al.,
bioRxiv - Genomics 2020
Quote:
... Samples were immunoprecipitated with 2 μL of either anti-Top2 (TopoGEN, #TG2014), anti-MYC 9E11 (Abcam ...
-
No products found
because this supplier's products are not listed.
Julie Van Coillie, et al.,
bioRxiv - Immunology 2022
Quote:
... IL-6 levels in the supernatant were measured by enzyme-linked immunosorbent assay (ELISA) using IL-6 CT205-c and CT205-d antibody pair (U-CyTech, Utrecht, the Netherlands) as described previously (1).
-
No products found
because this supplier's products are not listed.
Raquel Bartolome Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=5) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Microdialysis probes (2 mm; 38 kDa molecular weight cut off; BR-style; BASi) were inserted into the guide cannula ...
-
No products found
because this supplier's products are not listed.
Sebastian Fiedler, et al.,
bioRxiv - Biochemistry 2020
Quote:
Anti-SARS-CoV-2 seropositive human serum samples (convalescent) were obtained from BioIVT. BioIVT sought informed consent from each subject ...
-
No products found
because this supplier's products are not listed.
Brady G. Anderson, et al.,
bioRxiv - Systems Biology 2023
Quote:
Fecal samples were weighed into pre-tared 2 mL Precellys® (Bertin Corp.) compatible vials ...
-
No products found
because this supplier's products are not listed.
Nick Quinn-Bohmann, et al.,
bioRxiv - Systems Biology 2023
Quote:
Fecal samples were collected in 1200 mL 2-piece specimen collectors (Medline, USA) in the Public Health Science Division of the Fred Hutchinson Cancer Center (IRB Protocol number 10961 ...
-
No products found
because this supplier's products are not listed.
Xingyu Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 2.5:0.1,2.5:0.5, 2.5:1, and 2.5:2, 1.5 MDa sodium hyaluronate from Lifecore Biomedical). The gel solutions were incubated at 37°C overnight and were then submerged in deionized water at room temperature ...
-
No products found
because this supplier's products are not listed.
Adrian Kendal, et al.,
bioRxiv - Cell Biology 2021
Quote:
... a 7 % w/v polymer solution of PDO (Riverpoint Medical, Portland, Oregon , USA) in 1,1,1,3,3,3-Hexafluoro- 2-propanol (HFIP, Halocarbon Product Corporation ...
-
No products found
because this supplier's products are not listed.
Emily Speranza, et al.,
bioRxiv - Immunology 2021
Quote:
... slides were de-waxed according to a standard protocol of 2 washes of Xylene (Newcomer Supply) for 10 minutes each ...
-
No products found
because this supplier's products are not listed.
Natalie J. Norman, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 999 ± 2 µg/ml in 0.2% (v/v) HNO3(CGC1) inorganic carbon standard (Inorganic Ventures, USA). All other chemicals and salts were trace metal grade (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Marta Bermejo-Jambrina, et al.,
bioRxiv - Immunology 2023
Quote:
... and SARS-CoV-2 RNA was extracted using FavorPrep Viral RNA Minikit (FAVORGEN, Ping-Tung, Taiwan), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lauren G. Buss, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Cells were exposed to a single dose of 5 Gy irradiation (X-ray, RS 2000 Small Animal Irradiator, Rad Source). The untreated cells were shielded with >6 mm lead.