-
No products found
because this supplier's products are not listed.
Cristina Solana-Manrique, et al.,
bioRxiv - Neuroscience 2020
Quote:
... were performed with MTT (3-(4, 5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) (Sigma-Aldrich) as described in Sanz et al ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Erika Girardi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5-diphenyl-2-H-tetrazolium bromide) assay (Invitrogen) was performed to follow the proliferation of KO-SFPQ or siSFPQ HCT116 cells compared to WT or siCtrl HCT116 cells respectively ...
-
No products found
because this supplier's products are not listed.
Kate Harris, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 4-(2-Butyl-6,7-dichloro-2-cyclopentyl-indan-1-on-5-yl) oxobutyric acid (DCPIB; Tocris), superoxide dismutase (SOD ...
-
No products found
because this supplier's products are not listed.
Annamarie E. Allen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were incubated in treatment media for the indicated period of time and then MTS reagent ((3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) purchased from Abcam, (ab197010 ...
-
No products found
because this supplier's products are not listed.
Thomas S. Lisse,
bioRxiv - Cancer Biology 2020
Quote:
... The MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide) assay was performed according to the manufacturer’s recommendation (10009365, Cayman Chemicals). After incubation with the MTT reagent ...
-
No products found
because this supplier's products are not listed.
Angela Armento, et al.,
bioRxiv - Cell Biology 2024
Quote:
... bFGF 5 ng/ml (day 2-4, AF-100-18B, Peprotech), activinA 100 ng/ml (day 4-14 ...
-
No products found
because this supplier's products are not listed.
El Batoul Djouani-Tahri, et al.,
bioRxiv - Plant Biology 2023
Quote:
... before to add chemiluminescent substrate CSPD® (disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2’-(5’-chloro)tricyclo [3.3.1.13,7]decan}-4-yl) phenyl phosphate) (Roche). The chemio-luminescent signal was detected by using a G-Box (Syngene).
-
No products found
because this supplier's products are not listed.
Martijn Selten, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Silke J.A. Lochs, et al.,
bioRxiv - Genomics 2023
Quote:
... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
No products found
because this supplier's products are not listed.
Laila Shehata, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 ug of recombinant mouse IL-4 (BioLegend) was diluted to 150 uL with sterile PBS and administered i.v ...
-
No products found
because this supplier's products are not listed.
Eszter Somogyi, et al.,
bioRxiv - Immunology 2020
Quote:
... the media were refreshed and supplemented with 5 ng/mL IL-7 or 5 ng/mL IL-7 and 4 ng/ml IL-2 (R&D Systems), respectively ...
-
No products found
because this supplier's products are not listed.
Jae-Hyun Yoon, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 diphenyl tetrazolium bromide (MTT, Corning) was added to each well in the 96-well plates ...
-
No products found
because this supplier's products are not listed.
Liang Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
No products found
because this supplier's products are not listed.
Ayşe Kılıç, et al.,
bioRxiv - Systems Biology 2023
Quote:
... anti–IL-4 (5 µg/mL; BD Biosciences); Th2 cells ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 5% v/v 2-mercaptoethanol) and fractionated by 4-15% Tris-Glycine gel (Bio-Rad Cat#5678084) using Tris-Glycine running buffer (0.2M Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Antonio Astorga-Gamaza, et al.,
bioRxiv - Immunology 2024
Quote:
... for 4 hours and 5 mM ATP (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Adeline Pastuszka, et al.,
bioRxiv - Microbiology 2024
Quote:
... Bacteria are centrifuged (5 min, 5 000 rpm, pre-cooled 4°C, Eppendorf 5430R) and pellets washed two times (500 mM sucrose ...
-
No products found
because this supplier's products are not listed.
G. Unali, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2% glutamine and 5% human serum AB (Lonza) for seven days ...
-
No products found
because this supplier's products are not listed.
Konstadinos Moissoglu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Aaron T. Kuan, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Slices were washed with ddH2O 5 x 5 minutes at 4°C on ice and were placed in aqueous 2% uranyl acetate (EMS, #22400) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Martineau Éric, et al.,
bioRxiv - Neuroscience 2020
Quote:
... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
No products found
because this supplier's products are not listed.
Jiayi Zhao, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 4’,6-diamidino-2-phenylindole (DAPI) was diluted to 5 μg/mL in Vectashield antifade mounting media (Vector Laboratories).
-
No products found
because this supplier's products are not listed.
O.G.G. Almeida, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Rajprasad Loganathan, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... embryos were fixed in 4% glutaraldehyde (Polysciences; Cat#18428-5) and 2% acrolein (Sigma ...
-
No products found
because this supplier's products are not listed.
Anthony Flamier, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and passaging every 4-5 days using ReLeSR (StemCell technologies). hES-qualified Matrigel (Corning ...
-
No products found
because this supplier's products are not listed.
Suruchi Sethi, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 2 mM TCEP) and incubated for 1 hour at 4°C before loading on Superose 6 5/150 column (GE Healthcare) equilibrated with the same buffer on an AKTA-micro system (GE Healthcare) ...
-
No products found
because this supplier's products are not listed.
GaYoung Park, et al.,
bioRxiv - Bioengineering 2024
Quote:
... hydrogels of varying Young’s modulus: 5 kPa (4% 20 kDa 4-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), 12 kPa (5% 40 kDa 8-arm PEG-NB ...
-
No products found
because this supplier's products are not listed.
Dannielle K. Zierath, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mice (4–5 weeks old; Jackson Labs, Bar Harbor, ME) were group-housed throughout the infection and monitoring period (5/cage) ...
-
No products found
because this supplier's products are not listed.
Diego J. Páez-Moscoso, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 4 cm of 5-μm strong cation exchange resin (Luna; Phenomenex), and 8 cm of reverse-phase C18 resin57 ...
-
No products found
because this supplier's products are not listed.
Steven Tau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Plates were imaged every 3-4 d on a Cytation 5 (BioTek) with 4x magnification and phase contrast ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
Pericytes viability was assessed using the 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assay according to the manufacturer’s procedure (Cell Signaling Technology). Cells were plated at the appropriate concentration in 96-well plates under different experimental conditions ...
-
No products found
because this supplier's products are not listed.
Fatmanur Tiryaki, et al.,
bioRxiv - Cell Biology 2021
Quote:
... for 5 minutes at 4°C with TLA100 rotor (Beckman). 100 µg cell lysate was brought to a final volume of 250 µl BRB80 supplemented with 1 mM GTP ...
-
No products found
because this supplier's products are not listed.
Marcel-Joseph Yared, et al.,
bioRxiv - Biochemistry 2022
Quote:
... then 5 mL Optiphase ‘HISAFE’ 2 scintillation cocktail (PerkinElmer) were added ...
-
No products found
because this supplier's products are not listed.
Zac Chatterton, et al.,
bioRxiv - Genomics 2022
Quote:
... 0.25 μL of Proteinase K (Zymo, D3001-2-5), and 2.5μL of H2O ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Jamie Guenthoer, et al.,
bioRxiv - Immunology 2024
Quote:
... Omicron BA.4/BA.5 (Sino Biological, cat. 40589-V08H32), Omicron XBB (Sino Biological ...
-
No products found
because this supplier's products are not listed.
Nicolò Mangraviti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 5 ng/ml human FGF-2 (Miltenyi Biotec). Then ...
-
No products found
because this supplier's products are not listed.
Chris Y. Cheung, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cell nucleus was defined and exposed to 405 nm laser light for 4-5 times 200ms bursts at ∼5% 405 nm laser power (TCS SP8 MP, Leica). After photoconversion of Dendra2-RUVBL2 ...
-
No products found
because this supplier's products are not listed.
Alexia Polissidis, et al.,
bioRxiv - Neuroscience 2021
Quote:
For GBA quantification (n=5 for 4 WPI, n=3 for 8 WPI), the surface function of the Imaris software was used to select only GFP-positive cells by appropriately adjusting the number of voxels as well as the intensity of the GFP channel in the threshold tab ...
-
No products found
because this supplier's products are not listed.
Salman Tamaddon-Jahromi, et al.,
bioRxiv - Cell Biology 2023
Quote:
SKOV-3 cells transfected without or with 100nM siRNA and simultaneously treated with 10μM 5-Aza-Cdr for 4 days were seeded into 2-well cell culture inserts (Ibidi, UK). After cell attachment (6h) ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Muhammad Saad Yousuf, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These chunks were immersed in 5 ml of pre-warmed enzyme solution (2 mg/mL STEMzyme I, 4 µg/mL DNAse I obtained from Worthington Biochemical #LS004107 and #LS002139) in Hanks’ Balanced Salt Solution (HBSS ...
-
No products found
because this supplier's products are not listed.
Mario Mietzsch, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3.5 μL was applied to a glow-discharged Quantifoil copper grid with 2 nm continuous carbon support over holes (Quantifoil R 2/4 400 mesh), blotted ...
-
No products found
because this supplier's products are not listed.
Samuel Hume, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and using 5 μg anti-NUCKS1 antibody (ProteinTech 12023-2-AP) or 5 μg normal rabbit IgG (SantaCruz sc2027) ...
-
No products found
because this supplier's products are not listed.
Francesco Roncato, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Images were acquired at a rate of one frame every 4-5 min for 4 h using an IX83 inverted microscope (Olympus) equipped with UPlanFLN 20x/0.50 Ph1 ∞/0.17/FN 26.5 objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Hattie Chung, et al.,
bioRxiv - Genomics 2021
Quote:
... 5% normal donkey serum and 5% normal goat serum (Jackson Immunoresearch) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Anjali Bajpai, et al.,
bioRxiv - Genetics 2021
Quote:
... Images containing 5 Z-stacks were captured for quantification (100x magnification) on Axioplan-2 using Axiovision version-4 camera (Carl Zeiss). The intensity of fluorescence of FITC and Cy3 was quantified from the projected images using the LSM-FCS Version 3.2SP software (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Danyang Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Data were acquired and filtered (at 5 kHz 4-pole Bessel filter) with MultiClamp 700B amplifier (Molecular Devices), digitized with Digidata 1440A (Molecular Devices ...