-
No products found
because this supplier's products are not listed.
Luca Braglia, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Each reaction was carried out with 4 μL master mix (Titan HotTaq EvaGreen, BIOATLAS), 0.5 μL of each primer (from a 100 μM stock ...
-
No products found
because this supplier's products are not listed.
Pengchao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... for 2 min and then subjected to the imaging system (UVITEC Cambridge) to record signals.
-
No products found
because this supplier's products are not listed.
Johann Peltier, et al.,
bioRxiv - Microbiology 2020
Quote:
... Western blotting was performed with anti-HA antibodies (1:2, 000) (Osenses) using standard methods.
-
No products found
because this supplier's products are not listed.
Weihan Gu, et al.,
bioRxiv - Pathology 2023
Quote:
... and then subcultured in 15-ml minimal medium with a 100-fold dilution in a 50-ml culture tube (Crystalgen, USA). When the bacterial culture was grown to an OD600 of target value (0.5 ...
-
No products found
because this supplier's products are not listed.
Elizabeth Fleming, et al.,
bioRxiv - Microbiology 2021
Quote:
... sites were swabbed rigorously using 2 PurFlock Ultra buccal swabs (Puritan Medical Products) for each site for thirty seconds before one swab was submerged into a 1.5mL Eppendorf tube containing 500μl R2A broth (R2A ...
-
No products found
because this supplier's products are not listed.
Joanne L. Usher, et al.,
bioRxiv - Cell Biology 2021
Quote:
... were spiked in at concentrations as indicated in the Supplementary Table 1 and the sample was loaded into a StageTip containing 4 plugs of C18 substrate (SPE-Disks-Bio-C18-100.47.20, AffiniSEP) that had been assembled ...
-
No products found
because this supplier's products are not listed.
Charlène Iltis, et al.,
bioRxiv - Immunology 2021
Quote:
... membranes were stripped at 4°C in agitation using Antibody stripping buffer 1X for 10 minutes (Gene Bio-Application). Protein bands were quantified using ImageJ software ...
-
No products found
because this supplier's products are not listed.
Brian C. Russo, et al.,
bioRxiv - Microbiology 2021
Quote:
... The cells were then incubated overnight at 4°C with rabbit anti-Shigella conjugated to FITC (ViroStat, catalog no. 0903). The next day ...
-
No products found
because this supplier's products are not listed.
Lama El Cheikh Hussein, et al.,
bioRxiv - Neuroscience 2021
Quote:
... tail-tip blood (6 µl) was collected from 4 mice at ZT7 and ZT12 to check corticosterone levels (ELISA kit From Assaypro).
-
No products found
because this supplier's products are not listed.
Asvin KK Lakkaraju, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1.5 ug plasmid DNA was mixed with 500 ng linearized BAC10:KO1629 DNA (Oxford Expression Technologies Ltd.) and 8 ul Cellfectin™ II reagent (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anuj kumar Murmu, et al.,
bioRxiv - Genomics 2022
Quote:
The predicted peptide sequence of Mucin 2 of indigenous duck was derived by Edit sequence (Lasergene Software, DNASTAR) and then aligned with the peptide of other chicken breed and avian species using Megalign sequence Programme of Lasergene Software ...
-
No products found
because this supplier's products are not listed.
Takao Fujisawa, et al.,
bioRxiv - Cell Biology 2023
Quote:
Recombinant proteins or ZnCl2 solution for normalization was incubated with 10 µM ZnAF-2 (Goryo Chemical, SK2001-01) in TBS for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Yuichiro Honda, et al.,
bioRxiv - Pathology 2020
Quote:
... The sections were blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with a mouse anti-CD-11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland) or a rabbit polyclonal anti-dystrophin primary antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
0.5 μg RNA was mixed with 4 μL 5X reaction buffer and 1 μL RTase (AzuraQuant cDNA synthesis kit, Azura Genomics cat: AZ1996). Reaction mix was incubated at 42°C for 30 min and denatured at 85°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Sarah C. Donnelly, et al.,
bioRxiv - Microbiology 2022
Quote:
... samples containing 1–3 mg/mL of protein were evaluated using ICP-MS (Biotron Analytical Services, Western University, London, Canada). Briefly ...
-
No products found
because this supplier's products are not listed.
Max Z. Levine, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... the remaining pellet was transferred to a cold 50 mL Falcon tube using a sterile spatula (SmartSpatula□, LevGo, Inc., Berkeley, CA) while kept on ice ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Unekwu M. Yakubu, Kevin A. Morano,
bioRxiv - Biochemistry 2021
Quote:
α-synuclein thioflavin T binding assays were performed by incubating 2 μM α-synuclein monomer (StressMarq Biosciences, Victoria, BC, Canada), 1 μM pre-formed fibrils (StressMarq Biosciences ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Dorothee Jakob, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... we applied the spider toxin peptide Grammostola spatulata mechanotoxin 4 (GsMTx4) L-isomer (10 μmol/L, H20 as solvent, CSBio, Menlo Park, CA, USA), a known blocker of cation non-selective SAC ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Hongbing She, et al.,
bioRxiv - Genomics 2020
Quote:
... The PCR was performed in a total reaction volume of 10 μL containing 5 μL 2×Taq Master Mix (CoWin Biosciences, China), 0.25 μL forward and reverse primer ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Gaurang Patel, et al.,
bioRxiv - Cell Biology 2020
Quote:
... followed by 20 minutes of boiling at 90°C in Pretreat 2-target retrieval buffer treatment (ACD, 320043) in Oster Steamer (IHC World, LLC, Model 5709) and 30 minutes of Pretreat 3-using protease plus treatment (ACD ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...
-
No products found
because this supplier's products are not listed.
Beatriz Garcia-Diaz, et al.,
bioRxiv - Neuroscience 2019
Quote:
... anti-EphA4-Tyr(602) (1:50, ECM Biosciences, EP2731); anti-EphB6 (1:50 ...
-
No products found
because this supplier's products are not listed.
Chloe G Myers, et al.,
bioRxiv - Cell Biology 2024
Quote:
... or IGF-1 (25, 50, 100 nM, GroPep Bioreagents), at different doses for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Nairi Hartooni, et al.,
bioRxiv - Biophysics 2021
Quote:
... 24×50 mm high precision glass cover slips (Bioscience Tools) and drilled microscope slides were passivated with a combination of PEG and PEG-biotin (cover slips ...
-
No products found
because this supplier's products are not listed.
Zhiyi Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... NIH/3T3 SMAD2/3-luciferase reporter cell line (Signosis) was co-cultured with BALF ...
-
No products found
because this supplier's products are not listed.
D.K. Wilton, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and a micromanipulator MM33 (Pipette.com 3-000-024-R). Mice were subsequently allowed to recover on a warm plate before being transferred back to their home cage ...
-
No products found
because this supplier's products are not listed.
Catherine C. Neto, et al.,
bioRxiv - Microbiology 2021
Quote:
... quercetin-3-O-galactoside or hyperoside (Chromadex, Irvine, CA); procyanidin-A2 (Indofine Inc. ...
-
No products found
because this supplier's products are not listed.
Thomas A. Desautels, et al.,
bioRxiv - Microbiology 2023
Quote:
... diluted to 50-100 nM in RexxipF buffer (Gyros Protein Technologies). Resulting values were fit to a 4PL model or calculated as area under the curve (AUC ...
-
No products found
because this supplier's products are not listed.
Yuan-Chen Tsai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... AP-5 (50 μM, almone labs) and tetrodotoxin (1 μM, Affix Scientific). 10 min after establishing the whole-cell mode ...
-
No products found
because this supplier's products are not listed.
Rajender Nandigama, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and 50 µL of Dylight 648-labeled Isolectin GS-B4 (Nordic-MUbio, Susteren ...
-
No products found
because this supplier's products are not listed.
Margaret M. McDaniel, Vitaly V. Ganusov,
bioRxiv - Immunology 2019
Quote:
... We fitted either recirculation model (panels A&C, see eqns. (3)–(9) ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... magnetic beads were conjugated with monoclonal capture antibodies (mAB47:3, UmanDiagnostics), incubated with diluted mouse serum (1:8 or 1:16 dilution ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Natalia Sanchez de Groot, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Aβ42 was inserted 3’prime of the GFP (TRP-URA-AB vector) using the In-Fusion® HD Cloning Kit (Clontech ...
-
No products found
because this supplier's products are not listed.
Elisa Tonoli, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 30 μg/ml TG2 (Zedira) in ACSF was perfused until plateau of the response was reached ...
-
No products found
because this supplier's products are not listed.
Biao Yuan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and desalting (3 min) was driven with an isocratic HPLC pump (IPro-500, IRIS Technologies, Lawrence, KS) at a flow rate of 100 µL min-1 through the 50-µL sample loop ...
-
No products found
because this supplier's products are not listed.
Pedro Gonzalez-Menendez, et al.,
bioRxiv - Physiology 2022
Quote:
... Surface GLUT1 and SLC7A1 expressions were monitored by binding to their retroviral envelope ligand (RBD) fused to eGFP for GLUT1 (1:25 dilution in 50 µls; Metafora biosystems) or to the RBD-rFc fusion protein for SLC7A1 (1:25 dilution in 50 µl ...