-
No products found
because this supplier's products are not listed.
Sonali Gupta, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 0.01 .mM para-hydroxy benzoic acid (Sigma), 0.01 mM thiamine (Sigma) ...
-
No products found
because this supplier's products are not listed.
Jean de Montigny, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Probenecid (4-(dipropylsulfamoyl)benzoic acid) (water soluble form, ThermoFisher Scientific, P36400) was used at 1mM (after calibrating the effect between 250 µM and 1 mM).
-
No products found
because this supplier's products are not listed.
Fumiya Kozawa, et al.,
bioRxiv - Cell Biology 2024
Quote:
... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
No products found
because this supplier's products are not listed.
Dounia Dems, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Fmoc-(4-amino)benzoic acid and Fmoc-(4-aminomethyl)benzoic acid were purchased from VWR and Chem-Impex International Inc. ...
-
No products found
because this supplier's products are not listed.
Shigeo Takashima, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 14-eicosatrienoic acid (20:3 ω-6, sciadonic acid; Cayman Chemical, # 10009999), all cis-8 ...
-
No products found
because this supplier's products are not listed.
Romain D. Cazé, et al.,
bioRxiv - Neuroscience 2023
Quote:
D-AP5 (D-(−)-2-Amino-5-phosphonopentanoic acid) and SR 95531 (2-(3-Carboxypropyl)-3-amino-6-(4 methoxyphenyl) pyridazinium bromide) were purchased from Abcam, UK ...
-
No products found
because this supplier's products are not listed.
Fushun Wang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 6-Isopropoxy-9-xanthone-2-carboxylic acid (AH6809, 10 µM, Tocris); N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251 ...
-
No products found
because this supplier's products are not listed.
Kentson Lam, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Then 3-(4,5-dimethyl thiazol- 2-yl)-2,5-diphenyl tetrazolium bromide (MTT) labeling reagent (Roche) was added followed by solubilization buffer 2h later ...
-
No products found
because this supplier's products are not listed.
John B. Moldovan, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... approximately 2-3×105 cells were plated per well in 6-well plates (Corning) and transfected with 0.25 μg of “driver” plasmid (pTMO2F3 ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
Carlos J. Garcia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Authentic standards of 3,7-Dihydroxy-5-cholan-24-oic Acid (chenodeoxycholic acid) and 3-Hydroxy-11-oxo-5-cholan-24-oic Acid (3-oxo-chenodeoxycholic acid) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). The N-(3α,7α,12α-trihydroxy-5β-cholan-24-oyl)-glycine (glycocholic acid) ...
-
No products found
because this supplier's products are not listed.
Erika Atucha, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 6’-diamidino-2-phenylindole (DAPI; Vector Laboratories). Each in-situ hybridization included 1 slide for each group ...
-
No products found
because this supplier's products are not listed.
Sandip M. Swain, Rodger A. Liddle,
bioRxiv - Cell Biology 2020
Quote:
... 6-eicosatrienoic acid (Santa Cruz Biotechnology; sc-221066), arachidonic acid (Sigma ...
-
No products found
because this supplier's products are not listed.
Niels Frimodt-Møller, et al.,
bioRxiv - Microbiology 2023
Quote:
... 6 μL S30 premix without amino acids (Promega), plus water to a final reaction volume of 15 μL were incubated for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Nadine Honke, et al.,
bioRxiv - Immunology 2020
Quote:
... and 3-Iodo-L-tyrosine-treated B cells were labeled by using the Annexin V Fitc Apoptosis detection kit (BD, Heidelberg, Germany) according to manufacturer`s instructions ...
-
No products found
because this supplier's products are not listed.
Jessica Y Chen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mice used were 2-3-month-old C57BL/6 (Jackson Laboratories, Bar Harbor, ME, #000664) at the time of injury ...
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
M. Rebecca Glineburg, et al.,
bioRxiv - Neuroscience 2021
Quote:
Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
No products found
because this supplier's products are not listed.
Antonella Bordin, et al.,
bioRxiv - Cell Biology 2022
Quote:
Human umbilical vein endothelial cells (HUVEC) were cultured between passage 3 and 6 in EGM-2 complete medium (Lonza)3,52–55 ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Josephine R Paris, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... 3% dimethyl sulphoxide (DMSO) and 0.4 U of Taq-Phusion High-Fidelity (New England Biolabs, USA). PCR conditions were as follows ...
-
No products found
because this supplier's products are not listed.
Chérine Sifri, et al.,
bioRxiv - Molecular Biology 2023
Quote:
U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ...
-
No products found
because this supplier's products are not listed.
Rutger D. Luteijn, et al.,
bioRxiv - Immunology 2022
Quote:
... 2′3′- cyclic-di-GMP-AMP (2′3′-cGAMP) (Invivogen cat. no. tlrl-nacga23), and human IFN-β (PeproTech ...
-
No products found
because this supplier's products are not listed.
Michael H Jones, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 3 and 6 days and subsequently tested by IL-2 ELISA (R&D Systems) according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Ragunathan Bava Ganesh, Sebastian J. Maerkl,
bioRxiv - Synthetic Biology 2024
Quote:
... Purification column was prepared using 2-3 mL IMAC Sepharose 6 Fast Flow beads (GE Healthcare) and charged with 0.1 N Nickel sulphate solution ...
-
No products found
because this supplier's products are not listed.
Samaresh Malik, et al.,
bioRxiv - Microbiology 2023
Quote:
... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Masahiko Okada,
bioRxiv - Biochemistry 2022
Quote:
... 6 - trisulfonic acid (ProZyme, Inc., San Leandro, CA) at the reducing termini by reductive amination ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... fixed in Methacarn (1/3/6 mixture of acetic acid/chloroform/methanol) overnight at room temperature and stained with carmine alum (Stem Cell Technologies), or fixed in 4% paraformaldehyde overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 6-diamidino-2-phenylindole (DAPI) (Electron Microscopy Sciences, #17985-10) and viewed by confocal microscope (Leica SP8 ...
-
No products found
because this supplier's products are not listed.
Yoann Daniel, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... [2-14C] acetic acid (Perkin Elmer, NEC553050UC) and 50 µM cold acetic acid (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Hiroaki Takebe, et al.,
bioRxiv - Microbiology 2024
Quote:
... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Amédée Renand, et al.,
bioRxiv - Immunology 2020
Quote:
... sequences [SLA (p1-p53)] or 0.6 nmol/mL PepTivatorR Candida albicans MP65 (peptides pools of 15 amino acids length with 11 amino acid overlap, Miltenyi Biotec) in 5% human serum RPMI medium in the presence of 1µg/ml anti-CD40 (HB14 ...
-
No products found
because this supplier's products are not listed.
Gaoyang Liang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... A Luna C18(2) C8 column (3 μm, 2 mm × 50 mm, Phenomenex) was used ...
-
No products found
because this supplier's products are not listed.
Martin P. Steinbuck, et al.,
bioRxiv - Immunology 2024
Quote:
... custom 15mer OLPs with 11 amino acid overlap were generated spanning the SARS-CoV-2 Spike RBD WH-01 protein (amino acids R319-S591, GenScript). WH-01 peptides that contained VOC mutation loci were substituted with the corresponding mutant sequences when applicable ...
-
No products found
because this supplier's products are not listed.
Ning Tsao, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
No products found
because this supplier's products are not listed.
Malvina Pizzuto, et al.,
bioRxiv - Immunology 2024
Quote:
... or 6-well plates (2 mL/well) (Greiner Bio-One).
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Bram Meijlink, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Ultrasound was applied under an incidence angle of 45° in relation to the CLINIcell using a single element focused transducer (2.25 MHz center frequency, 76.2 mm focal length, -6 dB beam width at 2 MHz of 3 mm, V305, Panametrics-NDT, Olympus). The ultrasound pressure output was calibrated using a 1-mm diameter needle hydrophone (PA2293 ...
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Vikas D. Trivedi, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... OD600 measurement was checked at frequent time intervals (3-6 h) on SpectraMax M3 spectrophotometer (Molecular Devices). Growth rate was determined by plotting the values in GraphPad Prism following non-linear regression and using exponential growth equation ...
-
No products found
because this supplier's products are not listed.
Catherine Horiot, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant human IL-6 (2 ng/mL) (Proteintech) was added to RPMI1640 culture medium containing Ultraglutamine (Lonza ...
-
No products found
because this supplier's products are not listed.
Juhi Singh, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 6 mM 2-mercaptoethanol and centrifuged with a 70Ti (Beckman coulter) rotor at 40,000 rpm for 18 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Emily L. Meany, et al.,
bioRxiv - Bioengineering 2024
Quote:
... to 6 μM biotinylated wildtype SARS-CoV-2 spike trimer (Sino Biological, 40589-V27B-B) in five steps ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...