-
No products found
because this supplier's products are not listed.
Louis S. Prahl, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and N2 acrylic acid (0.1% w/v, acrylic acid-N-hydroxysuccinimide ester, A8060, Sigma) were successively added and mixed by vortexing ...
-
No products found
because this supplier's products are not listed.
Silvia Eckert, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and (Z)-hex-3-enyl-acetate (Thermo Fisher, Kandel, Germany) were applied directly in TD-glass tubes and measured in a concentration series (20-100 ng μL-1 ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... methyl ester (βARK1/GRK2 inhibitor; Cayman Chemicals, 24269-96-3), capadenoson (Cayman Chemicals ...
-
No products found
because this supplier's products are not listed.
Adetunji Alex Adekanmbi, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
No products found
because this supplier's products are not listed.
Arvid Herrmann, et al.,
bioRxiv - Plant Biology 2024
Quote:
... kC9 and its phosphonic acid ester form (P-[[(Acetyloxy)methoxy]-2-naphthalenylmethyl]-bis[(acetyloxy)methyl] ester phosphonic acid: 1) are also commercially available (abcam AB141566 and abcam141567, respectively). These compounds were diluted in DMSO and subjected for chemical treatment ...
-
No products found
because this supplier's products are not listed.
Crozat Elysa, et al.,
bioRxiv - Neuroscience 2024
Quote:
... α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA, Tocris Bioscience), Kainate and N-methyl-D-aspartate acid (NMDA ...
-
No products found
because this supplier's products are not listed.
Sarah E Hancock, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... A 37-component fatty acid methyl ester standard (Merck Life Sciences) containing an additional 3.184 nmol of methyl nonadecanoate was concurrently subjected to the same derivatisation procedure and used as an external quality control for fatty acid identification by LC-MS ...
-
No products found
because this supplier's products are not listed.
Hao Hu, et al.,
bioRxiv - Plant Biology 2022
Quote:
An authentic standard of lesquerolic acid methyl ester was purchased from Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Jennifer B. Phillips, et al.,
bioRxiv - Neuroscience 2023
Quote:
... then embedded in acrylic resin (EMS) and cut into 2 µm sections that were collected serially on glass slides ...
-
No products found
because this supplier's products are not listed.
Jia-Shuo Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... fluo-3 acetoxymethyl (Fluo-3 thereafter) ester (Biotium, US) following a protocol adapted from (Zhang et al. ...
-
No products found
because this supplier's products are not listed.
Shinya Ohara, et al.,
bioRxiv - Neuroscience 2021
Quote:
... They were treated to a 1:1 mixture of 100% ethanol and methyl salicylate for 10 minutes before clearing and storage in methyl salicylate (VWR Chemicals).
-
No products found
because this supplier's products are not listed.
Kanishk Jain, et al.,
bioRxiv - Biochemistry 2023
Quote:
... to S-adenosyl-L-[methyl-3H]-methionine ([methyl-3H]-SAM) (PerkinElmer)] ...
-
No products found
because this supplier's products are not listed.
Mouadh Benamar, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... mono-methyl Histone H4 (K20) (1:500, #9724; Cell Signaling), di-methyl Histone H4 (K20 ...
-
No products found
because this supplier's products are not listed.
Juan Qin, et al.,
bioRxiv - Biochemistry 2021
Quote:
... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ...
-
No products found
because this supplier's products are not listed.
Ritu Nayak, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding.
-
No products found
because this supplier's products are not listed.
Carlos J. Garcia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Authentic standards of 3,7-Dihydroxy-5-cholan-24-oic Acid (chenodeoxycholic acid) and 3-Hydroxy-11-oxo-5-cholan-24-oic Acid (3-oxo-chenodeoxycholic acid) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). The N-(3α,7α,12α-trihydroxy-5β-cholan-24-oyl)-glycine (glycocholic acid) ...
-
No products found
because this supplier's products are not listed.
Kevin C. Wilkins, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 500 mM Auxin (Indole-3-acetic acid) in DMSO (Corning #25950CQC) or DMSO alone were added at a 1:1000 dilution to the media ...
-
No products found
because this supplier's products are not listed.
Laura Hermans, et al.,
bioRxiv - Neuroscience 2021
Quote:
... An aqueous solutions of 25% (wt/vol) Poly(acrylic acid) (Polysciences, MW 50000) was spun at 2000 rpm (WS-650-23 ...
-
No products found
because this supplier's products are not listed.
Junghyun L. Suh, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
The effect of DMSO and methyl ester version compounds (compound 34–38) on cell viability was determined using a CellTiter-GloTM ATP detection system (Promega #7573). For testing DMSO tolerance ...
-
No products found
because this supplier's products are not listed.
Gianmatteo Vit, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PP2AC Methyl (Leu 309) (#828801, 1:3000, BioLegend), actin ...
-
No products found
because this supplier's products are not listed.
Cristiane Miranda Franca, et al.,
bioRxiv - Bioengineering 2022
Quote:
... acid solubilized Type 1 collagen from rat tail tendon (3 mg/mL, BD Biosciences) was reconstituted in an ice bath to a final concentration of 2.5 mg/mL ...
-
No products found
because this supplier's products are not listed.
C.W.E. Embregts, et al.,
bioRxiv - Immunology 2021
Quote:
... 1% nonessential amino acids (Lonza), 1 mM sodium pyruvate (Gibco ...
-
No products found
because this supplier's products are not listed.
Markus Brandhofer, et al.,
bioRxiv - Immunology 2022
Quote:
... Biotinylated human MIF was produced using D-biotinoyl- ε -aminocaproic acid-N-hydroxy-succinimide ester (Biotin-7-NHS) with the Biotin Protein Labeling Kit from Roche (Mannheim, Germany). Alternatively ...
-
No products found
because this supplier's products are not listed.
Wenjuan Yang, et al.,
bioRxiv - Immunology 2021
Quote:
... Caffeic acid phenethyl ester (CAPE) (R&D Systems), Mitoquinone (MitoQ ...
-
No products found
because this supplier's products are not listed.
Bradley M. Readnour, et al.,
bioRxiv - Microbiology 2021
Quote:
... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
No products found
because this supplier's products are not listed.
Joke De Jaeger-Braet, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the slides were washed in cold 3:1 ethanol:acetic acid and mounted in Vectashield medium with DAPI (Vector Laboratories).
-
No products found
because this supplier's products are not listed.
Weiwei Peng, et al.,
bioRxiv - Immunology 2023
Quote:
... in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS) buffer (Bio-rad). Bands were visualized with Imperial Protein Stain (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Jessica Tang, et al.,
bioRxiv - Genomics 2020
Quote:
... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Rayyan M. Gorashi, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Methyl-Lysine (MeK, 1:350, Novus Biologicals, NB600824), and acetylated lysine (AcK ...
-
No products found
because this supplier's products are not listed.
Seth D. Reighard, et al.,
bioRxiv - Immunology 2020
Quote:
... Following enumeration using 3% acetic acid with methylene blue (StemCell Technologies), splenocytes were resuspended in phosphate-buffered saline and forty to sixty million cells were injected either intraperitoneally or intravenously (via retro-orbital injection under isoflurane anesthesia ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Yuxi Ai, Dongming Liang, Jeremy E. Wilusz,
bioRxiv - Molecular Biology 2021
Quote:
... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
No products found
because this supplier's products are not listed.
P Chaudhary, et al.,
bioRxiv - Neuroscience 2020
Quote:
... neurotrophin-3 (NT-3, 1 ng/ml, PeproTech, Rocky Hill, NJ), and ciliary neurotrophic factor (CNTF,10 ng/ml ...
-
No products found
because this supplier's products are not listed.
Rasheduzzaman Rashu, et al.,
bioRxiv - Immunology 2023
Quote:
... with 50 μg of the Toll-like receptor (TLR)3 agonist polyinosinic-polycytidylic acid [poly (I:C)] (InvivoGen), 50 μg of the TLR7 agonist imiquimod (InvivoGen) ...
-
No products found
because this supplier's products are not listed.
Anushka Nayak, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and tri-methyl lysine (Abclonal). Anti-GAPDH-HRP was used to measure even loading.
-
No products found
because this supplier's products are not listed.
Naama Stern-Mentch, et al.,
bioRxiv - Neuroscience 2021
Quote:
... the fixed supraesophageal mass was glued with acrylic glue to a vibratome stage (Leica, VT1000 S). 50-90 µm sagittal ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Tiancheng Liu, et al.,
bioRxiv - Biochemistry 2020
Quote:
We conjugated IRDye800 CW NHS ester (LI-COR Biosciences) and CF647 NHS ester (Millipore Sigma ...
-
Primarily ribosomal RNA. Suitable substrate for ribonuclease assays.
Cat# LS003452,
100 mg, $68.00
Ask
Hazel Tye, et al.,
bioRxiv - Immunology 2023
Quote:
... 1% (w/v) fatty acid-free BSA (Worthington, USA) was prepared by dissolving fatty acid-free BSA in serum-free DMEM containing 4 μM L-glutamine ...
-
No products found
because this supplier's products are not listed.
Y. Edrei, et al.,
bioRxiv - Genomics 2021
Quote:
Methyl-seq-captured libraries were sequenced using a Hiseq2500 device (Illumina), by applying paired-end 125bp reads ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
No products found
because this supplier's products are not listed.
Yan Li, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Unc13-3 (1:1000, Synaptic systems, 126303), Synpo1 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Sally Martin, et al.,
bioRxiv - Genomics 2020
Quote:
... 1:100 B27 supplement without retinoic acid (Miltenyi Biotec) supplemented with 10 µM SB-431542 ...
-
No products found
because this supplier's products are not listed.
Sean C Piantadosi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... tertiary streptavidin conjugated Cy-3 (1:250 Jackson lab)].
-
No products found
because this supplier's products are not listed.
Tegan S. Horan, et al.,
bioRxiv - Genetics 2023
Quote:
... the cell pellet was resuspended in PBS supplemented with 2 % FCS and nucleated cells were counted in methylene blue with 3 % acetic acid on a Vi-Cell XR cell viability counter (Beckman Coulter). 10 × 106 bone marrow cells were resuspended in 200 μl of PBS supplemented with 2 % FCS containing the following antibody solution ...
-
No products found
because this supplier's products are not listed.
Kelsey Barrasso, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3-day old suckling CD-1 mice (Charles River Laboratories) were fasted for 1 hour ...
-
No products found
because this supplier's products are not listed.
Yichao Zhao, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... rabbit anti-pRPA2 (S33) (1:1000 for IB; Bethyl, A300-246A-3), mouse anti-CHK1 (1:1000 for IB ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...