-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H5,
1.0 ea, USD $1915.0
Ask
Nina Kessler, et al.,
bioRxiv - Immunology 2022
Quote:
cGAMP in human PBMCs was quantified with the 2’,3’-Cyclic GAMP ELISA Kit (Arbor assays) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Nina Kessler, et al.,
bioRxiv - Immunology 2022
Quote:
... cGAMP was measured in undiluted BALF using the 2’,3’-Cyclic GAMP ELISA Kit (Cayman Chemical) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Shikha Dagar, Susovan Sarkar, Sudha Rajamani,
bioRxiv - Biochemistry 2022
Quote:
... Cytidine 3′, 5′ cyclic monophosphate (3′, 5′ cCMP) and Cytidine 2′, 3′ cyclic monophosphate (2′, 3′ cCMP) were purchased from Sigma-Aldrich (Bangalore, India) and used without further purification ...
-
No products found
because this supplier's products are not listed.
Shurong Zhou, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The concentrations of 2’3’-cGAMP was measured using 2’3’-cyclic cGAMP ELISA kit (Invitrogen) following the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Ruo-yu Tang, Lan Yin, Liang Yao, Xiao-Ping Chen,
bioRxiv - Immunology 2022
Quote:
5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Xibing Xu, et al.,
bioRxiv - Microbiology 2024
Quote:
... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
No products found
because this supplier's products are not listed.
Blair K.A. Willette, Nikoleta G. Tsvetanova,
bioRxiv - Cell Biology 2022
Quote:
... 8-(4-Chlorophenylthio)adenosine 3’,5’-cyclic monophosphate (8-CPT-cAMP) was purchased from Abcam (Cat #ab120424), dissolved in water to 150mM stock ...
-
No products found
because this supplier's products are not listed.
Marion Darnaud, et al.,
bioRxiv - Microbiology 2021
Quote:
... and IGFBP-3 DuoSet ELISA kit (R&D Systems), respectively ...
-
No products found
because this supplier's products are not listed.
Jamil Mahmud, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5’-CGCCTTCGTTACAAGCATCG-3’; antisense, 5’-AAGAGCAAACGCATCTCCGA-3’), GAPDH (sense, 5’-ACCCACTCCTCCACCTTTGAC-3’; antisense, 5’-CTGTTGCTGTAGCCAAATTCGT-3’) using Green GoTaq master mix (Promega, Madison, WI) with C1000 Touch Thermal Cycler (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Mayoko Tsuji, et al.,
bioRxiv - Immunology 2023
Quote:
... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
No products found
because this supplier's products are not listed.
Mikael G. Pezet, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 0.1 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate sodium salt (Tocris) and 0.1 mM 3-Isobutyl-1-methylxanthine (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Laura Miguel-Romero, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
No products found
because this supplier's products are not listed.
Huan Du, et al.,
bioRxiv - Neuroscience 2021
Quote:
... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Kyle Wellmerling, et al.,
bioRxiv - Developmental Biology 2019
Quote:
3 60mm plates (Corning, CLS430166) of Day 9 hiPSC-NPCs were mixed and pumped through anti-SSEA-5 and isotype control functionalized GEDI chips at 1ml/hr for 30 min ...
-
No products found
because this supplier's products are not listed.
Marco S. Kaiser, et al.,
bioRxiv - Physiology 2021
Quote:
... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
No products found
because this supplier's products are not listed.
Simon d’Oelsnitz, et al.,
bioRxiv - Synthetic Biology 2024
Quote:
Incubate for 3 h and 5 min in a plate reader (Biotek Neo2SM).
-
No products found
because this supplier's products are not listed.
Clara Suñer, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
No products found
because this supplier's products are not listed.
Belinda Liu, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The plates were washed 3 times using PBST and then developed using an ELISA developing kit (BD Biosciences). The optical densities at 450 nm were read using an ELISA plate reader (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Katarzyna Zyla-Jackson, et al.,
bioRxiv - Immunology 2023
Quote:
... we incubated sequential de-paraffinized sections with anti-2’,3’-cyclic-nucleotide 3’-phosphodiesterase (CNPase) (mouse CNPase: 1:200 dilution; Biolegend, Inc.), anti-CD3 (rabbit ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Máté Kiss, et al.,
bioRxiv - Immunology 2020
Quote:
... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kathleen E. McGrath, et al.,
bioRxiv - Cell Biology 2024
Quote:
... IL-3 (5 ng/ml, Peprotech), and cholesterol-rich lipids (40 mg/mL ...
-
No products found
because this supplier's products are not listed.
Sravasti Mukherjee, et al.,
bioRxiv - Cell Biology 2023
Quote:
cAMP ELISA assay was performed using a Cyclic AMP XP® Assay Kit (#4339, Cell Signaling Technology) according to the manufacturers protocol ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Patricia Bilodeau, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5’-ATAAGCTCCCTGCCCGAGTC-3’ (Santa Cruz sc-430739).
-
No products found
because this supplier's products are not listed.
Tianqi Leng, et al.,
bioRxiv - Immunology 2019
Quote:
... ELISA plates (Greiner) were coated with 5μg/mL anti-CD3/28 with the final volume of 100μL at 4°C for overnight ...
-
No products found
because this supplier's products are not listed.
David A. Sykes, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Intracellular calcium was detected using a FLIPR calcium 5 no wash assay kit and read on a FlexStation 3 plate reader (Molecular Devices, Sunnyvale USA).
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 3’-deoxyadenosine-5’-triphosphate (3’-dATP, Jena Bioscience) at 2 mM and MgCl2 at 4 mM was incubated for 15 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... covered with a glass plate (3" x 3" glass plate from VWR Vertical Gel Electrophoresis Systems), exposed to 7.5 minutes of glass plate filtered (UVA only ...
-
No products found
because this supplier's products are not listed.
Deepa Ramasamy, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... was used for the estimation of global 5-hmC and 5-mC levels by ELISA using the Quest 5-hmC ELISA kit and the 5-mC DNA ELISA kit (Zymo research Inc, USA) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Valentina Fajner, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... CG42797EcoRI_F: 5’-CCGgaattcATGGAGCCACCAGCT-3’ and CG42797XhoI_R: 5’-TAGAGGTACCctcgagCTACTCAATGCCGAACGTGTTG-3’ and cloned by enzymatic digestion into a pGEX6P1(GE Healthcare).
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Y. Shi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 0.5mM adenosine 3’,5’-cyclic monophosphate (cAMP, Enzo Life Science), 2ng/ml transforming growth factor beta 3 (TGFβ3 ...
-
No products found
because this supplier's products are not listed.
Neil Fleck, Christoph Grundner,
bioRxiv - Genetics 2021
Quote:
... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
No products found
because this supplier's products are not listed.
Dairui Li, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Cells were passaged every 3–5 days with ReLeSR (STEMCELL Technologies). All cells used had a normal diploid karyotype.
-
No products found
because this supplier's products are not listed.
Alexander D. Silvagnoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Absorbance spectra were generated using a multipoint 3×3 well scan of each well from 450 to 700 nm with a plate reader (Tecan Spark). Preliminary experiments determined that there was a significant difference in absorption by the phantom pucks when the absorbance was read at room temperature (approx ...
-
No products found
because this supplier's products are not listed.
Senthil T. Kumar, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5 mg of 1,2-fioleoyl-sn-glycero-3-phosphoethanolamine (DOPE):1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS):1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) 5:3:2 w/w (Avanti Polar Lipids) were resuspended in 0.8 mL methanol:chloroform 1:1 ...
-
No products found
because this supplier's products are not listed.
Asya Smirnov, et al.,
bioRxiv - Microbiology 2022
Quote:
... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
No products found
because this supplier's products are not listed.
J Vial, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Caspase-3 activity assay was performed using Caspase 3 Fluorimetric Assay Kit (Biovision K105-400), according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sangeeta Goswami, et al.,
bioRxiv - Immunology 2022
Quote:
... 3′-3-diaminobenzidine (DAB) substrate (Leica Microsystems) was used as a chromogen followed by hematoxylin counterstain ...
-
No products found
because this supplier's products are not listed.
Robin Canac, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... using the Multi Tissue Dissociation Kit 3 (Miltenyi Biotec), and pooled ...
-
No products found
because this supplier's products are not listed.
Anna L. Vlasits, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Boroscillate pipettes (Sutter Instruments, 3-5 MΩ) were used for all recordings and whole-cell electrophysiology recordings were performed using a Multiclamp 700B amplifier (Molecular devices) ...
-
No products found
because this supplier's products are not listed.
X. Rosa Ma, et al.,
bioRxiv - Neuroscience 2021
Quote:
... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
No products found
because this supplier's products are not listed.
Christopher Rouya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3–5 x103 cells were seeded in 96-well plates and viable cell numbers were determined using the Incucyte (Sartorius) Adherent-Cell-by-Cell module ...
-
No products found
because this supplier's products are not listed.
Oliver D Caspari, et al.,
bioRxiv - Plant Biology 2022
Quote:
... selected for Paromomycin resistance were grown in 200μl TAP in 96-well plates under 50μmol photons m-2 s-2 for 3-5 days and then screened for Venus expression in a fluorescence plate reader (CLARIOstar, BMG Labtech) as described previously (Caspari ...