-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Simon Lind, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... as well as the P2Y2R antagonist AR-C118925XX (5-[[5-(2,8-Dimethyl-5H-dibenzo[a,d]cyclohepten-5-yl)-3,4-dihydro-2-oxo-4-thioxo-1(2H)-pyrimidinyl]methyl]-N-2H-tetrazol-5-yl-2-furancarboxamide) were obtained from Tocris (Abingdon, UK). Subsequent dilutions of receptor ligand and other reagents were made in Krebs-Ringer Glucose phosphate buffer (KRG ...
-
No products found
because this supplier's products are not listed.
Joseph Mills, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 3-(2-Methyl-5-nitro-imidazol-1-yl)-N-(2,2,2-trichloro-1-phenylamino-ethyl)-propionamide) (Sigma-Aldrich SML1503). Drugs were diluted in culture media at treatment.
-
No products found
because this supplier's products are not listed.
Nancy G. Azizian, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
No products found
because this supplier's products are not listed.
Annamarie E. Allen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were incubated in treatment media for the indicated period of time and then MTS reagent ((3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) purchased from Abcam, (ab197010 ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Krzysztof Mikołajczyk,
bioRxiv - Biochemistry 2024
Quote:
... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
No products found
because this supplier's products are not listed.
Theodoros Karantanos, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay (11465007001, Roche Diagnostics, Mannheim, Germany) was performed according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2024
Quote:
... disodium;4-[3-pyridin-2-yl-6-(4- sulfonatophenyl)-1,2,4-triazin-5-yl]benzenesulfonate hydrate (Ferrozine, VWR) All media components were autoclaved or sterilized using 0.2 μm PES filters.
-
No products found
because this supplier's products are not listed.
Ana Cláudia Raposo, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100, Santa Cruz), 5-(hydroxymethyl)-2′-deoxycytidine-2H3 (#H946632 ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Qian Chen, et al.,
bioRxiv - Genomics 2020
Quote:
... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Pippa F. Cosper, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and stained with antibodies to α-tubulin (YL 1/2; 1:1000, Bio-Rad) and centromeres (HCT-0100 ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Jordan R. Barrett, et al.,
bioRxiv - Immunology 2023
Quote:
... were derived from a cell sort that included an additional cell hashing step (TotalSeq-C0251/C0252/C0253/C0254/C0255 anti-human Hashtag 1/2/3/4/5 antibodies, cat # 394661/394663/394665/394667/394669, Biolegend) prior to B cell enrichment and staining ...
-
No products found
because this supplier's products are not listed.
He-Yun Hsiao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Anastasia Selyutina, et al.,
bioRxiv - Microbiology 2020
Quote:
... supplemented with 5 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Corning, Corning, NY, USA), 50 μg/ml penicillin/streptomycin (Corning) ...
-
No products found
because this supplier's products are not listed.
Ashley N. Anderson, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by 3 x 5 minute washes in 2 × SSC (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
Pericytes viability was assessed using the 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assay according to the manufacturer’s procedure (Cell Signaling Technology). Cells were plated at the appropriate concentration in 96-well plates under different experimental conditions ...
-
No products found
because this supplier's products are not listed.
Martineau Éric, et al.,
bioRxiv - Neuroscience 2020
Quote:
... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
No products found
because this supplier's products are not listed.
Oksana Y. Dudaryeva, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and fibroblast growth factor 2 (FGF-2, 5 ng mL-1; PeproTech). Cells were passaged before reaching 90% confluency and the medium was changed every 2–3 days.
-
No products found
because this supplier's products are not listed.
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Addgene)[70] in a ratio of 5:3:2 using polyethylenimine (24765-2, Polysciences). Virus supernatant was harvested 30 h after transfection ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Ana Sofia Alberto-Silva, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... [3H]5-HT and [3H]1-methyl-4-phenylpyridinium ([3H]MPP+) were obtained from PerkinElmer, Inc (Waltham ...
-
No products found
because this supplier's products are not listed.
Robert C. C. Mercer, et al.,
bioRxiv - Neuroscience 2023
Quote:
... σ2R (26444-1-AP, Proteintech); β-actin (AC-74 ...
-
No products found
because this supplier's products are not listed.
Eric Franklin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 20% methyl-5-norbornene-2,3-dicarboxylic anhydride and 2% catalyst dimethylbenzylamine (Electron Microscopy Sciences) over four days ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Shun Kishimoto, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The triarylmethyl EPR oxygen tracer OX063 (methyl-tris[8-carboxy-2,2,6,6-tetrakis[2-hydroxyethyl]benzo[1,2-d:4,5-d0]-bis[1,3]dithiol-4-yl]-trisodium salt) was obtained from GE Healthcare.
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Yoon-Hee Jung, et al.,
bioRxiv - Genomics 2022
Quote:
Adult (2-5 months old) CD-1 IGS mice (Charles River Lab, USA) were used for all experiments ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Clayton E. Friedman, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 5 ng/mL FGF-2 (RnD Systems) and 1 µM CHIR99021 (Stem Cell Technologies) with daily medium exchange for 3 days ...
-
No products found
because this supplier's products are not listed.
Sawsan S Alamri, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated overnight at 4°C with the SARS-CoV-2 S1 subunit (amino acids 1–685) (Sino Biological, China) at 1 μg/ml in PBS (50 ul/well) ...
-
No products found
because this supplier's products are not listed.
Karthikeyan Thirugnanam, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Smad 2/3 (Novus Biologicals, Cat# AF3797, 1:200 dilution), GAPDH (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Lakmini S. Premadasa, et al.,
bioRxiv - Pathology 2024
Quote:
... Adapter-ligated fragments of 150-250bp and 250-300bp were recovered from a 2/5% NuSieve 1:1 agarose gel (Zymoclean Gel DNA Recovery Kit, Zymo Research). The fragments were then bisulfite treated using EX DNA Methylation-Lightning Kit (Zymo Research) ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Steven Tau, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Plates were imaged every 3-4 d on a Cytation 5 (BioTek) with 4x magnification and phase contrast ...
-
No products found
because this supplier's products are not listed.
Yu-Te Yeh, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and the post-nuclear supernatant was loaded onto an 8-step discontinuous sucrose density gradient (HEPES-buffered 0.2–2 M sucrose) and centrifuged at 55,000 rpm for 2h at 4 °C using an MLS50 rotor (Beckman Coulter). Extracellular acidification rate (ECAR ...
-
No products found
because this supplier's products are not listed.
Icaro Putinhon Caruso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
No products found
because this supplier's products are not listed.
Nicolò Mangraviti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and 5 ng/ml human FGF-2 (Miltenyi Biotec). Then ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Dapeng Li, et al.,
bioRxiv - Immunology 2022
Quote:
... was applied for 5 min to quench endogenous peroxidase activity prior to applying the SARS- CoV-2 antibody (1:2000, GeneTex, GTX135357). Antibodies were diluted in Background Reducing Antibody Diluent (Agilent) ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
David S Uygun, et al.,
bioRxiv - Neuroscience 2021
Quote:
... sIPSCs were recorded at −70 mV in the presence of the glutamate receptor antagonists (20 μM 6-cyano-7-nitroquinoxaline-2,3-dione +50 μM D-(2R)-amino-5-phosphonopentanoic acid) using a Multiclamp 700B amplifier and pClamp 10.0 software (Molecular devices; California, United States). A 1 min period after 5 min application of the glutamate receptor antagonists was used for statistical analysis (Igor software ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Poonam Roshan, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... NFIB (1:2000 in 2% milk, Bethyl), Snail (1:1000 ...