-
No products found
because this supplier's products are not listed.
Joseph Mills, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 3-(2-Methyl-5-nitro-imidazol-1-yl)-N-(2,2,2-trichloro-1-phenylamino-ethyl)-propionamide) (Sigma-Aldrich SML1503). Drugs were diluted in culture media at treatment.
-
No products found
because this supplier's products are not listed.
Matilda Shackley, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2-(4-chlorophenyl)-3-methyl-N-(thiazole-2-yl)butanamide (4-CMTB; Tocris) was used as a FFAR2-specific agonist and AR420626 (Cayman ...
-
No products found
because this supplier's products are not listed.
Nancy G. Azizian, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
No products found
because this supplier's products are not listed.
Michelle Y Meng, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... 3-[(2-methyl-1,3-thiazol-4-yl)ethynyl]pyridine (MTEP) hydrochloride was purchased from Abcam, and RO4 was a gift from Dr Wendy Winchester.
-
No products found
because this supplier's products are not listed.
Krzysztof Mikołajczyk,
bioRxiv - Biochemistry 2024
Quote:
... and untransfected cells were cultured for 2 weeks in a complete medium containing 3 μM N-[(1R,2R)-1- (2,3-dihydro-1,4-benzodioxin-6-yl)-1-hydroxy-3-pyrrolidin-1-ylpropan-2-yl]nonanamide (Genz-123346) (Merck, Darmstadt, Germany), a glucosylceramide synthase inhibitor [26].
-
No products found
because this supplier's products are not listed.
Maria-Luisa del Rio, et al.,
bioRxiv - Immunology 2024
Quote:
... and 2 mg/ml 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]2-[4-sulfophenyl]-2H-tetrazolium (PMS, Promega) (1/20 ...
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1-[2-chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-ribofuranuronamide (2-Chloro-IB-MECA; Cayman Chemicals, 163042-96-4), [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171 ...
-
No products found
because this supplier's products are not listed.
Dounia Dems, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Fmoc-(4-amino)benzoic acid and Fmoc-(4-aminomethyl)benzoic acid were purchased from VWR and Chem-Impex International Inc. ...
-
No products found
because this supplier's products are not listed.
Basila Moochickal Assainar, et al.,
bioRxiv - Biophysics 2023
Quote:
... 0.5% NBD-PC (1-palmitoyl-2-(6-[(7-nitro-2-1,3-benzoxadiazol-4-yl)amino]hexanoyl)-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.)) ...
-
No products found
because this supplier's products are not listed.
Cintia Checa-Rodríguez, et al.,
bioRxiv - Cell Biology 2023
Quote:
MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay (Roche) was performed following manufacturer’s indications ...
-
No products found
because this supplier's products are not listed.
Masayo Omura, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-methyl-2,4-nonanedione was purchased from Santa Cruz Biotechnology and Combi-Blocks.
-
No products found
because this supplier's products are not listed.
Adetunji Alex Adekanmbi, et al.,
bioRxiv - Microbiology 2021
Quote:
... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
No products found
because this supplier's products are not listed.
Alexa C. Cannon, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... PAK 1/2/3 1:1000 (Cell Signaling Technology Cat# 2604, RRID:AB_2160225), Myc-Tag 1:1000 (Cell Signaling Technology Cat# 2276 ...
-
No products found
because this supplier's products are not listed.
Shunya Kaneko, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2 mM DTT and 2 μCi/mL S-adenosyl-L-[methyl-14C] methionine (PerkinElmer). After 3h incubation ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Wyatt E. Lanik, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Corning) supplemented with 10% heat inactivated fetal bovine serum (Sigma) ...
-
No products found
because this supplier's products are not listed.
Florence E. McLean, et al.,
bioRxiv - Microbiology 2024
Quote:
... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
No products found
because this supplier's products are not listed.
Pippa F. Cosper, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and stained with antibodies to α-tubulin (YL 1/2; 1:1000, Bio-Rad) and centromeres (HCT-0100 ...
-
No products found
because this supplier's products are not listed.
Ritu Nayak, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were preserved in a 1:3 glacial acetic acid: methanol (Biolabs-chemicals) solution and karyotyped using g-banding.
-
No products found
because this supplier's products are not listed.
Angela C. Debruyne, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Poly(methyl methacrylate-co-methacrylic acid) (PMMA-MA; 10% methacrylic acid, MW ∼100,000 Da, 17913-500) was from Polysciences (USA), organic solvents were obtained from Carl Roth (Austria) ...
-
No products found
because this supplier's products are not listed.
Gantsetseg Tumurkhuu, et al.,
bioRxiv - Immunology 2024
Quote:
2’-3-cyclic GMP-AMP (cGAMP) (tlrl-nacga23-1, InvivoGen) was added at 10μg/mL with or without 4μM H151 (inh-h151 ...
-
No products found
because this supplier's products are not listed.
Eric Franklin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 20% methyl-5-norbornene-2,3-dicarboxylic anhydride and 2% catalyst dimethylbenzylamine (Electron Microscopy Sciences) over four days ...
-
No products found
because this supplier's products are not listed.
Theodora U. J. Bruun, et al.,
bioRxiv - Biochemistry 2022
Quote:
IQN17 was crystallized at room temperature in a hanging-drop vapor diffusion system by mixing 0.3 μL of 15 mg/mL peptide with 0.3 μL of reservoir solution containing 0.1 M imidazole (pH 8.0) and 35 % 2-methyl-2,4-pentanediol (MPD) (Qiagen). Crystals were seen two days after trays were set up ...
-
No products found
because this supplier's products are not listed.
He-Yun Hsiao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Gianmatteo Vit, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PP2AC Methyl (Leu 309) (#828801, 1:3000, BioLegend), actin ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
No products found
because this supplier's products are not listed.
Juan Qin, et al.,
bioRxiv - Biochemistry 2021
Quote:
... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Matilde Murga, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 2 and 1 ng/ml murine interleukin 3 (PeproTech, Rocky Hill, NJ, USA), respectively ...
-
No products found
because this supplier's products are not listed.
Joke De Jaeger-Braet, et al.,
bioRxiv - Cell Biology 2021
Quote:
... the slides were washed in cold 3:1 ethanol:acetic acid and mounted in Vectashield medium with DAPI (Vector Laboratories).
-
No products found
because this supplier's products are not listed.
Poshan V. Pokharel, et al.,
bioRxiv - Neuroscience 2024
Quote:
... cultures were cotreated with 20 nM (2S,3S)-2-Amino-3-methyl-N-[2-(4-morpholinyl)ethyl]pentanamide dihydrochloride (LM11a-31)(R&D Systems, Minneapolis, MN, USA, Cat no: 5046) or vehicle solution consisting of DMSO during application of 6-OHDA ...
-
No products found
because this supplier's products are not listed.
Rayyan M. Gorashi, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Methyl-Lysine (MeK, 1:350, Novus Biologicals, NB600824), and acetylated lysine (AcK ...
-
No products found
because this supplier's products are not listed.
Bethany C. Taylor, et al.,
bioRxiv - Systems Biology 2024
Quote:
... according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina) for the second read ...
-
No products found
because this supplier's products are not listed.
Katerina Stepankova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and anti-VGLUT1/2 (Synaptic Systems, #1235503, 1:800, 3 days). Goat anti-host antibodies of the respective primary antibodies conjugated with Alexa Fluor 405 ...
-
No products found
because this supplier's products are not listed.
Seth D. Reighard, et al.,
bioRxiv - Immunology 2020
Quote:
... Following enumeration using 3% acetic acid with methylene blue (StemCell Technologies), splenocytes were resuspended in phosphate-buffered saline and forty to sixty million cells were injected either intraperitoneally or intravenously (via retro-orbital injection under isoflurane anesthesia ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Chengyuan Wang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples (3 μl) were applied to Quantifoil 2/1 Cu 300 holey-carbon grids (Quantifoil) glow-discharged 60 s using a PELCO glow-discharge system (Ted Pella) ...
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Kasane Yaguchi, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 2–3 hours in secondary antibody 1:500 anti-chicken-IgY Alexa488-conjugated (Jackson ImmunoResearch cat# 703-545-155) in blocking solution ...
-
Primarily ribosomal RNA. Suitable substrate for ribonuclease assays.
Cat# LS003452,
100 mg, $68.00
Ask
Hazel Tye, et al.,
bioRxiv - Immunology 2023
Quote:
... 1% (w/v) fatty acid-free BSA (Worthington, USA) was prepared by dissolving fatty acid-free BSA in serum-free DMEM containing 4 μM L-glutamine ...
-
No products found
because this supplier's products are not listed.
Icaro Putinhon Caruso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
No products found
because this supplier's products are not listed.
Sawsan S Alamri, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated overnight at 4°C with the SARS-CoV-2 S1 subunit (amino acids 1–685) (Sino Biological, China) at 1 μg/ml in PBS (50 ul/well) ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Sally Martin, et al.,
bioRxiv - Genomics 2020
Quote:
... 1:100 B27 supplement without retinoic acid (Miltenyi Biotec) supplemented with 10 µM SB-431542 ...
-
No products found
because this supplier's products are not listed.
Eve T. Beauchemin, et al.,
bioRxiv - Microbiology 2022
Quote:
... the bacteria were first incubated in 3 wells of a 96-well plate for 1 hour in an Epoch 2 Microplate Spectrophotometer (BioTek), with optical density measured at 600 nm (OD600) ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 3 µg ml-1 of SARS-CoV-2 subunits diluted in carbonate-bicarbonate buffer (E107, Bethyl Laboratories), were coated in 384-well plates (microplate clear ...
-
No products found
because this supplier's products are not listed.
Tegan S. Horan, et al.,
bioRxiv - Genetics 2023
Quote:
... the cell pellet was resuspended in PBS supplemented with 2 % FCS and nucleated cells were counted in methylene blue with 3 % acetic acid on a Vi-Cell XR cell viability counter (Beckman Coulter). 10 × 106 bone marrow cells were resuspended in 200 μl of PBS supplemented with 2 % FCS containing the following antibody solution ...