-
Cat# ACT-IDMWD100,
USD $75.76/ea
Ask
Daniela Rubio-Olaya, et al.,
bioRxiv - Biophysics 2022
Quote:
... pH 8) in the presence of HydraGreen (3 mL, ACTGene, USA) as the intercalating agent ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Soner Sonmezoglu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... tris-(Bathophenanthroline) Ruthenium (II) Perchlorate (Ru(dpp)3(ClO4)2) (CAS 75213-31-9; GFS Chemicals), were immobilized on the surface of silica particles with a diameter of 10 µm (CAS 7631-86-9 ...
-
No products found
because this supplier's products are not listed.
Raniki Kumari, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 100 μl plasma was used for NE measurements using ELISA (NE High Sensitive ELISA Kit, Rocky Mountain Diagnostics) according to manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Steven C. Perry, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Oxylipin-treated platelets were stimulated with 0.25 µg/mL of collagen (Chrono-log), under stirring conditions (1100 rpm ...
-
No products found
because this supplier's products are not listed.
Manish Bodas, et al.,
bioRxiv - Cell Biology 2021
Quote:
... SCGB1A1 (5 μg/ml, catalog number RD181022220-01, BioVendor LLC, Asheville, NC, USA), KRT5 (2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Takao Fujisawa, et al.,
bioRxiv - Cell Biology 2023
Quote:
Recombinant proteins or ZnCl2 solution for normalization was incubated with 10 µM ZnAF-2 (Goryo Chemical, SK2001-01) in TBS for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Preeti Sareen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Fly arenas were prepared by pouring agarose based foods in two-compartment petri-dishes (90-100 mm diameter) from Kord Valmark, EMS ...
-
No products found
because this supplier's products are not listed.
Kaamini M. Dhanabalan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 85-100 kDa and 190-240 kDa (85:15) with carboxylic acid end groups were purchased from Akina (AP041, AP089, AP036) (West Lafayette ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
0.5 μg RNA was mixed with 4 μL 5X reaction buffer and 1 μL RTase (AzuraQuant cDNA synthesis kit, Azura Genomics cat: AZ1996). Reaction mix was incubated at 42°C for 30 min and denatured at 85°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Hui-Hsuan Kuo, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 10 μg ml−1 Oryza sativa-derived recombinant human transferrin (Optiferrin, InVitria, 777TRF029-10G,), 14 ng ml−1 sodium selenite (Sigma ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Gregory M Wright, et al.,
bioRxiv - Cell Biology 2023
Quote:
... FISH was performed using probes for the MT locus in 16q12.2 (56,396,107 to 56,782,063 on chromosome 16 in GRCh37) and chromosome 16 α-satellite purchased from Oxford Gene Technology, who performed paired-end sequencing to verify the identity of the BACs ...
-
No products found
because this supplier's products are not listed.
Thomas H Mahood, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 100 mM Tris) to 800 μL before loading onto 30 kDa molecular weight cut off filters (Amicron Ultra 0.5; Milipore; Burlington, MA). Once samples were loaded (10,000 xg ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
... Standards using mouse genomic DNA of known percentage methylation (0, 5, 25, 50, 75, and 100% 5mC) were obtained from EpigenDx (Hopkinton, MA) and included on each assay plate ...
-
No products found
because this supplier's products are not listed.
Kaitlyn Elizabeth Ellis, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Groups of flies — containing between 60 and 100 individuals — were introduced in a T-maze training apparatus (CelExplorer Labs Co., TMK-501) that was attached to a flowmeter that kept a constant stream of 0.7L/min (Dwyer Instruments ...
-
No products found
because this supplier's products are not listed.
Eduardo Seclen, et al.,
bioRxiv - Bioengineering 2024
Quote:
CD34+ HSPCs were transfected 48 hours after thawing and expansion by combining 5 μg of each AAVS1 TALEN mRNA or 10 μg of each CD11b TALEN mRNA with 1e6 HSPC in 100 μL BTXpress Solution (BTX Technologies, Hawthorne, NY, USA) and electroporating using the PulseAgile (Cellectis, Paris, France). One μg of Via-Enh01 mRNA and 4 μg of HDR-Enh01 mRNA were also included in the electroporation mix because Via-Enh0139 protein inhibits cell apoptosis and because HDR-Enh0140 increases homologous recombination by inhibiting the non-homologous-end-joining pathway ...
-
No products found
because this supplier's products are not listed.
Ryota Maeda, et al.,
bioRxiv - Molecular Biology 2021
Quote:
Antigen test kits detecting the SARS-CoV-2 spike based on nitrocellulose lateral flow assays were developed by Yamato Scientific Co. ...
-
No products found
because this supplier's products are not listed.
Samuel Schmidt, et al.,
bioRxiv - Cell Biology 2020
Quote:
... P/N was supplemented with β1,4 galactosidase at 150 mU/mL (QA-Bio, E-BG07), cleaving non-reduced terminal β1-4 galactose (G ...
-
No products found
because this supplier's products are not listed.
Dorota Kawa, et al.,
bioRxiv - Plant Biology 2022
Quote:
... very gently dried with a paper towel and weighed in 25 mL pycnometers (Eisco Labs) were filled with water and weighted ...
-
No products found
because this supplier's products are not listed.
G Loughran, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... at 10 μl/min flow rate and separated on a 50 cm × 100 μm analytical column home-packed (53) with Reprosil Pur C18 AQ 1.9 μm sorbent (Dr. Maisch HPLC GmbH, Germany) in 360 μm OD 100 μm ID polyimide coated fused-silica capillary with a laser-pulled emitter prepared on P2000 laser puller (Sutter ...
-
No products found
because this supplier's products are not listed.
Christopher D. Pull, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
We measured the foraging success of individual bees on exiting and re-entering the colony using weight-averaging scales for moving subjects (mean of three repeat measurements with 2s averaging and accuracy of ± 2 mg; Advanced portable balance Scout STX123 120g; OHAUS Corporation) and their lifetime foraging activity and survival using an RFID system (MicroSensys GmBH ...
-
No products found
because this supplier's products are not listed.
Sara Castagnola, et al.,
bioRxiv - Genomics 2020
Quote:
... was performed before cutting the brains sagittally in six equally thick sections (2 mm) using a mouse brain matrix slicer (CellPoint Scientific) and 5 razorblades ...
-
No products found
because this supplier's products are not listed.
Shuyong Jia, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The classic LDFs of both control points (points 1 and 2) were recorded by a PeriFlux 5000 (Perimed AB, Stockholm, Sweden) system with a 64-Hz sampling rate ...
-
No products found
because this supplier's products are not listed.
Geraldine Nouailles, et al.,
bioRxiv - Immunology 2022
Quote:
... The plates were covered and incubated for 2 h at room temperature before the washing step was repeated and 50 μL of secondary antibody (Brookwood biomedical, Rabbit Anti-Hamster IgA ...
-
No products found
because this supplier's products are not listed.
Shengyun Ma, et al.,
bioRxiv - Immunology 2022
Quote:
... 2’-deoxy-2’-fluoro-D-arabinonucleic acid (2’-FANA) containing CTL ASOs targeting a Trypanosoma gene (GCCGTTTACGTCGTCACAGA) or Malat1 (TTCTTTGCCTATCTTGAATGC) were purchased from AUM BIOTECH and their purities were confirmed by MALDI ...
-
No products found
because this supplier's products are not listed.
Ryan Murray, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were washed and cryopreserved in a 1:1 mixture of CS10 (BioLife Solutions) and Plasma-Lyte A (Hanna Pharmaceutical) supplemented with 2% HSA (Access Biologicals). Cryopreserved cells were thawed and activated with anti-CD3/anti-CD28 TransAct (Miltenyi ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. K. Ledger, Andrew M. Edwards,
bioRxiv - Microbiology 2023
Quote:
... or C3 was detected with a 1:1000 dilution of goat anti-human C3 F(ab’)2 labelled with FITC (Protos Immunoresearch). Antibody incubations were carried out statically for 1 h at room temperature in the dark ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
The human monocytic cell line U937 (ATCC CRL-1593.2) was obtained from ATCC and primary human peripheral monocytic cells (PBMCs) from two different donors were purchased from Precision for Medicine. U937 cells were cultured in RPMI 1640 media (VWR ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
Joshua F.E. Koenig, et al.,
bioRxiv - Immunology 2023
Quote:
... or 300 ng/ml NP-BSA conjugated to digoxigenin following supplier recommendations (ANP technologies, 90-1023-1KT) for 90 minutes at RT ...
-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Neha E. H. Dinesh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... For sanger sequencing PCR reactions were performed using specific oligos against the target FN domains (Supp Table 2) and Taq DNA Polymerase kit (ZmTech Scientifique; Catalogue #T207025) and analyzed on 2% agarose gels ...
-
No products found
because this supplier's products are not listed.
Jonathan Hus, et al.,
bioRxiv - Microbiology 2023
Quote:
... KS 66215 USA) were independently inoculated into a 10 ml Luria Broth (LB) medium (Aldon Corporation Rochester, NY). These were grown overnight to saturation in a 37°C incubator and shaken vigorously at 250 cycles per minute on a rotary shaker ...
-
No products found
because this supplier's products are not listed.
A. Rahman, et al.,
bioRxiv - Immunology 2019
Quote:
... Lysates (containing protein at 6mg/mL) from four donors were pooled prior to Kinex antibody microarray analysis (Kinexus Bioinformatics) (H ...
-
No products found
because this supplier's products are not listed.
Carmen RB da Silva, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... The volumetric flow rates produced by the flow controllers was measured using a Gilian Gilibrator–2 NIOSH Primary Standard Air Flow Calibrator with a low–flow cell (Sensidyne, LP, St Petersburg, FL, USA) and corrected to standard temperature pressure ...
-
No products found
because this supplier's products are not listed.
Sarah C. Donnelly, et al.,
bioRxiv - Microbiology 2022
Quote:
... samples containing 1–3 mg/mL of protein were evaluated using ICP-MS (Biotron Analytical Services, Western University, London, Canada). Briefly ...
-
No products found
because this supplier's products are not listed.
F. Esra Demircioglu, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The lysate was immediately mixed with 0.1 M phenylmethanesulfonyl fluoride (PMSF) (50 μl per 10 ml lysate) and 250 units of TurboNuclease (Eton Bioscience), and cleared by centrifugation ...
-
No products found
because this supplier's products are not listed.
Laura Ohl, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Tissue was mixed with 1 mL 40:40:20 methanol:acetonitrile:water (extraction solvent) and homogenized with a benchtop lyser (SciLogex OS20-S) at 1600 mhZ for approximately 15 sec ...
-
No products found
because this supplier's products are not listed.
Madhur Kalyan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... tb (0.1ml) were inoculated with 1:1 diluted blood (0.9 ml) in 7ml endotoxin free Sterilin Bijou tubes (Dynalab corporation, USA) and cultured for 4 days at 37ºC with slow shaking at 80 rpm.
-
No products found
because this supplier's products are not listed.
Max Z. Levine, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... the remaining pellet was transferred to a cold 50 mL Falcon tube using a sterile spatula (SmartSpatula□, LevGo, Inc., Berkeley, CA) while kept on ice ...
-
No products found
because this supplier's products are not listed.
Matthew Teryek, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Screened microcapsules were transferred back to bioreactors and resuspended in 60 mL dissociation solution that consisted of Cell Recovery Solution (TheWell Biosciences), 0.1% w/v L-Cysteine (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Cecilie Knudsen, et al.,
bioRxiv - Immunology 2022
Quote:
... The antibodies were gold-conjugated using 40 nm gold particles at 15 OD/mL from a Naked Gold Conjugation Kit (BioPorto Diagnostics, NGIB18) according to the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Rebecca C.S. Edgar, et al.,
bioRxiv - Microbiology 2023
Quote:
... Venous blood (5 mL) was collected by venipuncture and after removal of host white blood cells using Plasmodipur filters (EuroProxima B.V., The Netherlands), packed infected red blood cells (iRBCs ...
-
Cat# APS11141165B,
Inquire
No citation found on bioRxiv
-
Catalog Number: B2010630 (6 x 1 mL)
Traceable BSA Stock Solutions Kit (6 x 1 mL - 0-1000 ug/mL)...
Cat# B2010630,
USD $295.0
No citation found on bioRxiv
-
Reusable synthetic hemoglobin (100 ml)
Cat# BL-A012-0100,
1 unit, $333.00
No citation found on bioRxiv
-
Storage temperature of -20°C or below
Cat# 25-058-CI,
100mL, Inquire
No citation found on bioRxiv
-
Cat# CDC10-0325,
10 g, Inquire for price
No citation found on bioRxiv