-
No products found
because this supplier's products are not listed.
Mari Aikio, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... adenosine-2′,3′-dialdehyde (AdOx) (Sigma) or equal volume of DMSO vehicle was added to cells for 24 hours at a final concentration of 20 µM.
-
No products found
because this supplier's products are not listed.
Zachary Maschmann, et al.,
bioRxiv - Biophysics 2023
Quote:
... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
No products found
because this supplier's products are not listed.
Andrew J. Lee, et al.,
bioRxiv - Genomics 2022
Quote:
... adenosine addition at 3’ end (NEB, M0212), ligation of Illumina indexed adapters (NEB ...
-
No products found
because this supplier's products are not listed.
Jeremy Marshall, Ana Vargas, Kirstin Bett,
bioRxiv - Plant Biology 2022
Quote:
... 13C5-5-MTHF and 13C5-5-FTHF were purchased from Merck Eprova (Schaffhausen ...
-
No products found
because this supplier's products are not listed.
Shuhei Yoshida, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 1 mM adenosine 5’-O-(3-thiotriphosphate) (ATPγS, ab138911, abcam) was used instead of ATP for the kinase reaction ...
-
No products found
because this supplier's products are not listed.
Carlos G. Ardanaz, et al.,
bioRxiv - Neuroscience 2022
Quote:
... or 20 μM 2-methylthyo-adenosine-5’-triphosphate (2-MeSATP, Tocris, 1062) over a 5-min period ...
-
No products found
because this supplier's products are not listed.
David S. Milner, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... adenosine-tailed using GoTaq Flexi DNA polymerase (Promega), and cloned into pSC-A-amp/kn using a StrataClone PCR Cloning Kit (Agilent Technologies) ...
-
No products found
because this supplier's products are not listed.
Roberto Amigo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
No products found
because this supplier's products are not listed.
Khiem C. Lam, Quanyi Chen, Romina S. Goldszmid,
bioRxiv - Immunology 2024
Quote:
Bis-(3’-5’)-cyclic dimeric adenosine monophosphate (c-di-AMP) (#tlrl-nacda, InvivoGen) (see Note 3 ...
-
No products found
because this supplier's products are not listed.
Alona Botnar, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5 μCi 3H-adenosine (Perkin Elmer), or 10 μM EdA was supplemented ...
-
No products found
because this supplier's products are not listed.
Neha Nanajkar, et al.,
bioRxiv - Biophysics 2024
Quote:
... composed of 3:1 1palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC): 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoL-serine (POPS) (Avanti Polar Lipids, Alabaster, AL) were prepared using extrusion and sonication methods ...
-
No products found
because this supplier's products are not listed.
Paul-Lennard Mendez, et al.,
bioRxiv - Genomics 2024
Quote:
... SMAD2/3 (SMAD 2/3 XP, Cell Signaling Technology 8685) or isotype control (Rabbit IgG XP ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
A chromatographically purified, dialyzed, lyophilized powder. Prepared by a modification of the...
Cat# LS009043,
250 un, $210.00
Ask
Abigail M. Schwarz, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and adenosine deaminase (3 U/ml, Worthington) for 30 min followed by addition of agonists or vehicle control and incubated for 20 min ...
-
No products found
because this supplier's products are not listed.
Christian A. Faig, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Adenosine associated viruses (AAV) were acquired from Addgene and stored at -80°C in 3 µl aliquots ...
-
No products found
because this supplier's products are not listed.
Zhefu Que, et al.,
bioRxiv - Physiology 2021
Quote:
... 100 μM Cyclic adenosine monophosphate (cAMP) (Santa Cruz Biotechnology, Cat # sc-201567A), 200 μM ascorbic acid ...
-
No products found
because this supplier's products are not listed.
Patrick O. Byrne, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... IgG(1/2/3)-FITC (BD Pharmingen), and IgM-PE-Cy7 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Ersin Akinci, et al.,
bioRxiv - Genetics 2020
Quote:
... and adenosine monophosphate (AMP, Cayman Chemical) was measured spectrophotometrically through a pyruvate kinase/lactate dehydrogenase coupled assay that monitors NADH oxidation50,63,64 ...
-
No products found
because this supplier's products are not listed.
Konstantinos Sofiadis, et al.,
bioRxiv - Genomics 2020
Quote:
... donors (passage 2-3; Lonza) were continuously passaged to replicative exhaustion in complete Endopan-2 supplemented with 2% FBS under 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Ravikanth Maddipati, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
No products found
because this supplier's products are not listed.
Jooyoung Kim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... for 2 min and 3% lead citrate (EMS, #22410) for 1 min ...
-
No products found
because this supplier's products are not listed.
Yu H. Sun, et al.,
bioRxiv - Genomics 2020
Quote:
... This mixture was aliquoted in 2-3 cryovials (Corning, NY), secured on an aluminum cryocane ...
-
No products found
because this supplier's products are not listed.
George Tzertzinis, et al.,
bioRxiv - Biochemistry 2023
Quote:
The human ADGF (Recombinant Human Adenosine deaminase 2/CECR1) #7518-AD-010 was from R&D Systems, Minneapolis ...
-
No products found
because this supplier's products are not listed.
Amanda J Eakin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... rat anti-mouse Mac-2 (Galectin-3, 125402, Biolegend) for myeloid cells (Ho and Springer 1982) ...
-
No products found
because this supplier's products are not listed.
Yuting Wang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 2-3 months old male young (Jackson Lab #00664) or 2-3 months old GFP+ male young (Jackson Lab #006567 ...
-
No products found
because this supplier's products are not listed.
Hiroaki Takebe, et al.,
bioRxiv - Microbiology 2024
Quote:
... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
No products found
because this supplier's products are not listed.
Kamal L Nahas, et al.,
bioRxiv - Cell Biology 2021
Quote:
3 mm gold EM grids with a holey carbon film (R 2/2, 200 mesh; Quantifoil Cat no ...
-
No products found
because this supplier's products are not listed.
Ann Castelfranco, Pepe Alcami,
bioRxiv - Neuroscience 2023
Quote:
... and 3% lead citrate (Ultrostain 2, Leica).
-
No products found
because this supplier's products are not listed.
Giulio Donati, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 2 ng/mL murine interleukin 3 (PeproTech, Rocky Hill, NJ, USA). Prior to experiments involving IACS-010759 ...
-
No products found
because this supplier's products are not listed.
Marta E. Stremska, et al.,
bioRxiv - Immunology 2023
Quote:
... 3 μm (#19118-2; Polysciences) or 6 μm (#17145-4 ...
-
No products found
because this supplier's products are not listed.
Sina Ibne Noor, et al.,
bioRxiv - Biochemistry 2020
Quote:
... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
No products found
because this supplier's products are not listed.
Takashi Handa, Rie Harukuni, Tomoki Fukai,
bioRxiv - Neuroscience 2020
Quote:
... and filled with 2-3% Neurobiotin (Vector Laboratories) dissolved in 0.5 M potassium chloride (9-19 MΩ) ...
-
No products found
because this supplier's products are not listed.
Jacob P. Fredrikson, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The devices were plasma bonded to 3 x 2 in glass slides (VWR) for drop makers and 25 x 25 mm type 0 coverslips (VWR ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Ella J. Gehrke, et al.,
bioRxiv - Genetics 2023
Quote:
... OCT was performed at 2- and 3-weeks post-injection (WPI), then 1- ...
-
No products found
because this supplier's products are not listed.
Damien Detraux, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cells were passaged every 2-3 days using accutase (Stemcell Technologies, #07920). Cells were then collected by centrifugation at 1200 rpm for 3 minutes and counted before seeding ...
-
No products found
because this supplier's products are not listed.
Suphia Rafique,
bioRxiv - Plant Biology 2021
Quote:
... 100 mM DTT and 2% v/v IPG buffer pH 3– 10 (GE Healthcare) was applied to the strips ...
-
No products found
because this supplier's products are not listed.
Mandi M. Wiley, et al.,
bioRxiv - Genetics 2023
Quote:
... and end-labeled with (γ-P32) adenosine triphosphate (MP Biomedicals or Perkin Elmer, #NEG002A250U) using T4 polynucleotide kinase (NEB ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
A. Cassiopeia Russell, Dennis E. Kyle,
bioRxiv - Microbiology 2021
Quote:
... is directly proportional to the amount of adenosine triphosphate (ATP) in each well and was measured at 490 nm with a SpectraMax I3X plate reader (Molecular Devices, Sunnyvale, CA, USA). To generate drug susceptibility curves ...
-
No products found
because this supplier's products are not listed.
Qiao Wen Tan, Emmanuel Tan, Marek Mutwil,
bioRxiv - Plant Biology 2024
Quote:
... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
No products found
because this supplier's products are not listed.
Christos Georgiadis, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3% human serum (Seralab) +20 ng/ml human recombinant IL-2 (Miltenyi Biotec) and activated with TransAct reagent (Miltenyi Biotec) ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
No products found
because this supplier's products are not listed.
Vaky Abdelsayed, et al.,
bioRxiv - Biophysics 2022
Quote:
... including 2-color and 3-color STORM was performed on an IX83 Inverted microscope (Olympus) using a 100x 1.3NA objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Wenchao Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... SUMO 2/3 (Proteintech, cat. 11251-1-ap, 1:1000 for WB); Ubiquitin (Proteintech ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Anna Ruzhanskaya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... One was through twice daily measurement of 2 or 3 levels of QC specimens obtained from Beckman Coulter Inc ...
-
No products found
because this supplier's products are not listed.
Wricha Mishra, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The laser was focused onto layer 2/3 cortex through a 16x water-immersion objective lens (0.8NA, Nikon), and Ca2+ transients were obtained from neuronal populations at a resolution of 512 × 512 pixels (sampling rate ...
-
No products found
because this supplier's products are not listed.
Adrian W Hodel, et al.,
bioRxiv - Immunology 2024
Quote:
... turbidity was monitored in 2-minute intervals at 600 nm absorption using a Cytation 3 plate reader (BioTek, Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
Juwel Chandra Baray, et al.,
bioRxiv - Immunology 2020
Quote:
... The plate was washed for 3 times then incubated with mouse sera and SARS-CoV-2 Spike antibody (Sino Biological, China) for 2 hours at 37 °C ...