1 - 50 of 506
suppliers found for
10 UNDECENYLDIMETHYLCHLOROSILANE
» view 7178 matched products-
BOC Sciences Sponsored
Cat# 18406-97-8, Inquire Ask
-
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017, published in eLife doi: 10.7554/elife.32282Quote: ... and 10 ng/ml GDNF (Peprotech, #450-10-10)) ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... Interleukin 10 (IL-10, Abcam) at 5 ng/ml ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-10 (Gibco), 2.5 μg/ml CpG oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTCGTT ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... cholera toxin (10−10 M) (Sigma), hydrocortisone (0.4 μg/μL ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... 10% glycerol using PD-10 columns (GE healthcare). If required YpfP was concentrated using a Vivaspin 20 30MWCO until 2.4 mg/ml ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: ... 1×10-10 M Cholera toxin (Merck, C8052), 10 ng/ml Epidermal Growth Factor (EGF ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Animal Behavior and Cognition 2018, published in eLife doi: 10.7554/elife.34414Quote: ... treated T25 tissue culture flask (Corning # 10-126-10) using sterile technique ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Genomics 2019Quote: ... followed by adding 10 µL PNK (10 U/µL, NEB). The mixture was incubated for 30 min at 37 °C with shaking at 800 rpm ... -
Roche
No products found because this supplier's products are not listed.Cited in Loss of Shp1 impairs myeloid cell function and causes lethal inflammation in zebrafish larvaebioRxiv - Developmental Biology 2022Quote: ... 10% glycerol + 1:10 cOmplete mini protease inhibitor cocktail (Roche)) by incubation on ice followed by sonication (Bioruptor ... -
Molecular Devices
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2020Quote: Clampfit 10 (pCLAMP 10, Molecular Devices), Origin 9.1 (OriginLab Corp. ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... kisspeptin-10 (kisspeptin-10; 10 μg/1 µl; Tocris Bioscience; Minneapolis, MN) was administered to the DBB to determine the ability of kisspeptin to rescue the LH surge in the absence of neuroprogesterone ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in Nature Metabolism doi: 10.1038/s42255-020-0266-xQuote: ... and 10 ml nipagin (10% in ethanol, #25605.293, VWR), where they were allowed to lay eggs for 24 h ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2017, published in Scientific Reports doi: 10.1038/s41598-017-17689-0Quote: ... Pretreatment with 10 μM SB203580 and 10 μM SP600125 (Invivogen) or the corresponding vehicle DMSO was performed for 30 min prior to infection. -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... 10 % formamide (Calbiochem), 1 % Tween-20 ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 10% FBS (Lonza), 1% sodium pyruvate ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Evolutionary Biology 2022Quote: ... we dissolved 10 μg of protein in 10 μl 10 M urea containing 0.1% ProteasMax (Promega. Madison, WI, USA). Cysteine residues were reduced with 5 mM DTT (30 min at 50 °C ... -
New Objective
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2018, published in PLOS ONE doi: 10.1371/journal.pone.0211180Quote: ... 10 µm tip (New Objective), a spray voltage of 2.2 kV was applied ... -
Atlanta Biologicals
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020, published in Journal of Biological Chemistry doi: 10.1074/jbc.RA120.013752Quote: ... 10% FBS (Atlanta Biologicals), 1% penicillin and streptomycin ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Genomics 2019, published in Cell doi: 10.1016/j.cell.2020.06.037Quote: ... 10 µl of 10 mM dNTPs (Clontech #639125), 2.5 µl RNase Inhibitor (Lucigen) ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2021Quote: ... 10 well 10% TBE-Urea Gel (Bio-Rad) and run for 40 minutes at 200 V ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.Cited in Fragment-based discovery of a new class of inhibitors targeting mycobacterial tRNA modificationbioRxiv - Biochemistry 2019, published in Nucleic Acids Research doi: 10.1093/nar/gkaa539Quote: ... 10% OADC (BD), 0.05 mg/ml L-leucine ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... IL-10 (Biolegend, USA), IL-1β ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2022Quote: ... 10% CloneR (StemCell Technologies), and 1 μM Pifithrin-α hydrobromide (Tocris) ... -
MedChemExpress
Cat# HY-15580-1 mg, 1 mg, USD $300.0 AskbioRxiv - Molecular Biology 2021Quote: ... 10 μM THZ1 (MedChemExpress) was added to the reaction containing TFIIH to impaired the kinase activity of TFIIH ... -
R&D Systems
No products found because this supplier's products are not listed.Cited in Neural inflammation alters synaptic plasticity probed by 10 Hz repetitive magnetic stimulationbioRxiv - Neuroscience 2020Quote: ... interleukin 10 (10 ng/ml; mouse recombinant, R&D Systems #417-ML) was added to the culturing medium ... -
Selleck Chemicals
10-Gingerol is a bioactive compound found in ginger with anti-inflammatory and antioxidant activity.Cat# S9091, SKU# S9091-1mg, 2mg, $147.00 AskbioRxiv - Pharmacology and Toxicology 2020, published in Journal of Biological Chemistry doi: 10.1074/jbc.RA120.014061Quote: ... or 10 µM VX-770 plus 10 µM VX-809 (Selleck Chemicals). The assay is currently run using 96-well plates but small changes could make it compatible to a 384 well plate format. -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019Quote: ... The 10 μl reaction mixes contained1 μl of 10× reaction buffer (Qiagen), 0.8 μl dNTP ... -
Vector Labs
No products found because this supplier's products are not listed.Cited in RUNX1 marks a luminal castration resistant lineage established at the onset of prostate developmentbioRxiv - Developmental Biology 2020, published in eLife doi: 10.7554/eLife.60225Quote: ... sections were incubated for 10 min with 10% Casein (Vector Laboratories) diluted in TBS-T ... -
Cytoskeleton
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017, published in The Journal of Cell Biology doi: 10.1083/jcb.201611104Quote: ... along with 10 µM verapamil (Cytoskeleton, Inc.; 10 mM stock) to prevent dye efflux. -
Olympus
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... equipped with 10× objective lens (UPLAPO 10×, 0.4 N.A.; Olympus), a filter set (59022 ... -
Gold Biotechnology
No products found because this supplier's products are not listed.Cited in Identification of plant enhancers and their constituent elements by STARR-seq in tobacco leavesbioRxiv - Plant Biology 2020Quote: ... The center 8-10 cm of the second leaf from 7-9 plants were cut into thin strips perpendicular to the veins and immediately submerged in 10 mL protoplasting solution (0.6 M mannitol, 10 mM MES, 15 mg/mL cellulase R-10 [GoldBio] ... -
ApexBio
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019Quote: ... 10 μM SB202190 (ApexBio) and 100 μg/ml Primorcin (Invitrogen) ... -
Euroclone
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 10% horse serum (Euroclone, #ECS0090D), 1% Chicken Embryo Extract (Seralab ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... pH 10) and buffer B (10 mM ammonium formate, 90% ACN, 10% H2O, pH 10) using an Agilent 1200 HPLC (Agilent Technologies, Santa Clara, USA). In total ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... Then 10 mM MgCl2 and 10 μCi [α-32P] UTP (PerkinElmer) were added to the beads to elongate the nascent RNAs for 10 min ... -
Pan Biotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... 10% FCS (PAN Biotech) with 25 ng/ml Flt3L (Peprotech) ... -
Omega Scientific
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... 10% FBS (Omega Scientific), 2mM L-glutamine (Gibco ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... 10 μM Cilengitide (Cayman Chemical) or 1 μM MMP-2/MMP-9 inhibitor I (Millipore) ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2017, published in iScience doi: 10.1016/j.isci.2019.02.026Quote: ... DMAP1 (Santa Cruz; B-10), anti-RbbP4 (Abcam) ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... and 10% PhiX (Illumina) spike-in ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Zoology 2020, published in PLOS Neglected Tropical Diseases doi: 10.1371/journal.pntd.0009074Quote: ... 10 wells (Genscript, Nanjing, China). Gels were stained with Coomassie brilliant blue using eStainTM L1 (Genscript). -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018, published in Genetics doi: 10.1534/genetics.119.302063Quote: The DNA sequence of GFP1-10 was amplified from pcDNA3.1-GFP1-10 (Addgene #70219) and cloned into pGH8 (Prab-3: ... -
3M
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2022Quote: ... 10 µM VAC1 (stock solution 10−3M in DMSO) for 2.5 h (Dünser et al. ... -
LC Laboratories
LC Laboratories' Product Number N-8207 - Nilotinib, Free Base (Tasigna, AMN-107), >99% - for...Cat# N-8207, SKU# N-8207_250mg, 250 mg, $47.00 AskbioRxiv - Cell Biology 2018, published in eLife doi: 10.7554/eLife.42619Quote: ... calyculin A (10 µM in 10% EtOH) from LC labs, RO-3306 (10 µM ... -
Sartorius
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020, published in PLOS ONE doi: 10.1371/journal.pone.0242890Quote: ... 10 kDa MWCO (Sartorius), connected to the diafiltration reservoir (Sartorius ... -
Miltenyi Biotec
No products found because this supplier's products are not listed.bioRxiv - Immunology 2018Quote: ... IL-10 (Miltenyi Biotec), TLR9 (BD Biosciences) ... -
Research Diets
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... n=10 control and n=10 KO were fed formulated chow (Research Diets, D12450K), which had a caloric density of 5.49 kcal/gram and a macronutrient composition of 10% fat ... -
Greiner
No products found because this supplier's products are not listed.Cited in C-type lectin-like receptor 2 (CLEC-2)-dependent DC migration is controlled by tetraspanin CD37bioRxiv - Cell Biology 2017, published in Journal of Cell Science doi: 10.1242/jcs.214551Quote: ... supplemented with 10% FCS (Greiner Bio-One ... -
Peak Serum
No products found because this supplier's products are not listed.bioRxiv - Genomics 2021Quote: ... with 10% FBS (Peak Serum), pen-strep (Gibco ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... Sections (10 uM, Leica CM3050) were mounted onto electrostatically charged slides and images were collected using a Nikon TiS Microscope and associated software.