-
No products found
because this supplier's products are not listed.
Caroline M. Weight, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10-10 Cholera Toxin (Sigma) and 2x10-9 Triodothyronine (Sigma)) ...
-
No products found
because this supplier's products are not listed.
Michelle Hoffner O’Connor, et al.,
bioRxiv - Immunology 2021
Quote:
... 10 ng/mL recombinant IL-10 (PeproTech, #210-10), or vehicle control for 12 hours followed by the addition of 50 ng/mL LPS (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Vidhya M. Ravi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Interleukin 10 (IL-10, Abcam) at 5 ng/ml ...
-
No products found
because this supplier's products are not listed.
Na Xiao, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 10 ng/ml IL-10 (Gibco), 2.5 μg/ml CpG oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTCGTT ...
-
No products found
because this supplier's products are not listed.
Elaine Yang, et al.,
bioRxiv - Biophysics 2020
Quote:
Clampfit 10 (pCLAMP 10, Molecular Devices), Origin 9.1 (OriginLab Corp. ...
-
No products found
because this supplier's products are not listed.
Xiao Tian, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 10 μL GlycoBuffer 2 (10 ×) (NEB), 10 μL 10% NP-40 (NEB) ...
-
No products found
because this supplier's products are not listed.
Renée Moerkens, et al.,
bioRxiv - Cell Biology 2024
Quote:
... SB202190 (10 µM, Tocris #1264/10), A83-01 (500 nM ...
-
No products found
because this supplier's products are not listed.
Kasumi Murai, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 1×10-10 M Cholera toxin (Merck, C8052), 10 ng/ml Epidermal Growth Factor (EGF ...
-
No products found
because this supplier's products are not listed.
Elisabeth Lambert, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 10% glycerol using PD-10 columns (GE healthcare). If required YpfP was concentrated using a Vivaspin 20 30MWCO until 2.4 mg/ml ...
-
No products found
because this supplier's products are not listed.
Alexander M. Loiben, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 40% Ham’s F-10 (Corning Cellgro # 10-070-CV), 15% fetal bovine serum (Corning Cellgro # 35-010-CV) ...
-
No products found
because this supplier's products are not listed.
Zita Carvalho-Santos, et al.,
bioRxiv - Physiology 2019
Quote:
... and 10 ml nipagin (10% in ethanol, #25605.293, VWR), where they were allowed to lay eggs for 24 h ...
-
No products found
because this supplier's products are not listed.
Dipasree Hajra, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10% SDS) buffer containing 10% protease inhibitor cocktail (Roche) for 30 min on ice ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 10% OADC (BD), 0.05 mg/ml L-leucine ...
-
No products found
because this supplier's products are not listed.
Signe Mosegaard, et al.,
bioRxiv - Immunology 2023
Quote:
... IL-10 (BioLegend® Cat ...
-
No products found
because this supplier's products are not listed.
Ivan Koludarov, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... we dissolved 10 μg of protein in 10 μl 10 M urea containing 0.1% ProteasMax (Promega. Madison, WI, USA). Cysteine residues were reduced with 5 mM DTT (30 min at 50 °C ...
-
No products found
because this supplier's products are not listed.
Justus M Kebschull, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 10 % formamide (Calbiochem), 1 % Tween-20 ...
-
No products found
because this supplier's products are not listed.
Yi-Ting Yeh, et al.,
bioRxiv - Microbiology 2021
Quote:
... 10% FBS (Lonza), 1% sodium pyruvate ...
-
Cat# HY-15580-1 mg,
1 mg, USD $300.0
Ask
Siamak Redhai, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... the organoids were treated with 10 uM DB07268 (Medchemexpress, HY-15737-10) for 72 hours ...
-
No products found
because this supplier's products are not listed.
Emily C. Gale, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 10 µg MPLA (Invivogen), 20 µg CpG ODN 1826 (Invivogen) ...
-
No products found
because this supplier's products are not listed.
Sannula Kesavardhana, et al.,
bioRxiv - Immunology 2020
Quote:
... 10% FBS (Atlanta Biologicals), 1% penicillin and streptomycin ...
-
No products found
because this supplier's products are not listed.
Anna Sueki, et al.,
bioRxiv - Microbiology 2019
Quote:
... 10 µm tip (New Objective) and an applied spray voltage of 2.4 kV ...
-
No products found
because this supplier's products are not listed.
Kohei Otomo, et al.,
bioRxiv - Bioengineering 2023
Quote:
... GL Sciences, Tokyo, Japan, F10-G-10, 10 × 10 mm2; F10-G-20, 20 × 10 mm2, a polystyrene cuvette: BIO-RAD, Hercules, CA, #1702415, 10 × 10 mm2), and was placed on a suspended sample stage combined with a θ stage (Thorlabs ...
-
No products found
because this supplier's products are not listed.
Weixiang Fang, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 10% CloneR (StemCell Technologies), and 1 μM Pifithrin-α hydrobromide (Tocris) ...
-
No products found
because this supplier's products are not listed.
Arnav Moudgil, et al.,
bioRxiv - Genomics 2019
Quote:
... 10 µl of 10 mM dNTPs (Clontech #639125), 2.5 µl RNase Inhibitor (Lucigen) ...
-
No products found
because this supplier's products are not listed.
Pooja S. Sakthivel, et al.,
bioRxiv - Neuroscience 2023
Quote:
... IL-10 (R&D Systems, cat#21-7IL0-10), or C1q (My Biosource ...
-
No products found
because this supplier's products are not listed.
Joanna W. Jachowicz, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 10% FBS (Omega Scientific), 2mM L-glutamine (Gibco ...
-
No products found
because this supplier's products are not listed.
Raquel Ordoñez, et al.,
bioRxiv - Genomics 2023
Quote:
... 10 μg payload DNA and 10 μg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
No products found
because this supplier's products are not listed.
Osvaldo Artimagnella, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... - 10% FBS (Euroclone) - 1X Pen-Strep (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Niclas Olsson, et al.,
bioRxiv - Immunology 2021
Quote:
... pH 10) and buffer B (10 mM ammonium formate, 90% ACN, 10% H2O, pH 10) using an Agilent 1200 HPLC (Agilent Technologies, Santa Clara, USA). In total ...
-
No products found
because this supplier's products are not listed.
Tobias Jores, et al.,
bioRxiv - Plant Biology 2020
Quote:
... The center 8-10 cm of the second leaf from 7-9 plants were cut into thin strips perpendicular to the veins and immediately submerged in 10 mL protoplasting solution (0.6 M mannitol, 10 mM MES, 15 mg/mL cellulase R-10 [GoldBio] ...
-
No products found
because this supplier's products are not listed.
Martin Golkowski, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Linsitinib (10 µM, ApexBio).
-
No products found
because this supplier's products are not listed.
Sawa Iwasaki-Yokozawa, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Using 10 × objective lens (UPlanAPO 10×/0.40, Olympus), bright-field and fluorescence 500 × 500 pixel images were acquired every 5 min at exposure times of 10 msec and 100 msec ...
-
10-Gingerol is a bioactive compound found in ginger with anti-inflammatory and antioxidant activity.
Cat# S9091, SKU# S9091-1mg,
1mg, $147.00
Ask
Stella Prins, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... or 10 µM VX-770 plus 10 µM VX-809 (Selleck Chemicals). The assay is currently run using 96-well plates but small changes could make it compatible to a 384 well plate format.
-
No products found
because this supplier's products are not listed.
Kentaro Itokawa, et al.,
bioRxiv - Genetics 2019
Quote:
... The 10 μl reaction mixes contained1 μl of 10× reaction buffer (Qiagen), 0.8 μl dNTP ...
-
No products found
because this supplier's products are not listed.
Massar Alsamraae, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 10% FBS (Peak Serum), and 1% penicillin/streptomycin ...
-
No products found
because this supplier's products are not listed.
Hila Shaim, et al.,
bioRxiv - Immunology 2020
Quote:
... 10 μM Cilengitide (Cayman Chemical) or 1 μM MMP-2/MMP-9 inhibitor I (Millipore) ...
-
No products found
because this supplier's products are not listed.
Renaud Mevel, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... sections were incubated for 10 min with 10% Casein (Vector Laboratories) diluted in TBS-T ...
-
No products found
because this supplier's products are not listed.
Zhe Sun, et al.,
bioRxiv - Microbiology 2020
Quote:
... Then 10 mM MgCl2 and 10 μCi [α-32P] UTP (PerkinElmer) were added to the beads to elongate the nascent RNAs for 10 min ...
-
No products found
because this supplier's products are not listed.
Taiki Satoh, et al.,
bioRxiv - Immunology 2021
Quote:
... 10% FCS (PAN Biotech) with 25 ng/ml Flt3L (Peprotech) ...
-
No products found
because this supplier's products are not listed.
L. Monet Roberts, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 10% FetalPURE (Genesee Scientific ...
-
No products found
because this supplier's products are not listed.
Katri Vaparanta, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 10% horse serum (PromoCell), 5% fetal calf serum (Biowest) ...
-
No products found
because this supplier's products are not listed.
Alwyn Dady, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... TFAPα (1/10, Santa Cruz), HNK1 (1/10 ...
-
No products found
because this supplier's products are not listed.
Ritvija Agrawal, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Taxol-stabilized microtubules with ∼10% biotin-tubulin and ∼10% fluorescent-tubulin (Cytoskeleton) were prepared as described previously51 ...
-
No products found
because this supplier's products are not listed.
S. Hijazi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 10 µM CNQX (HelloBio) and 10 µM Gabazine (HelloBio ...
-
LC Laboratories' Product Number N-8207 - Nilotinib, Free Base (Tasigna, AMN-107), >99% - for...
Cat# N-8207, SKU# N-8207_250mg,
250 mg, $47.00
Ask
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 10 µM cyclopamine (LC Laboratories) was added to R-GECO1 cells 16 h prior to imaging.
-
No products found
because this supplier's products are not listed.
Ziyun Shen, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 10 kD filters (Pall, USA), Oasis HLB solid phase extraction column (Waters ...
-
No products found
because this supplier's products are not listed.
Xuebin Zhang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Images were acquired using a DMI 6000B microscope with 10 × 10 magnification (Leica). The Image J software (NIH ...
-
No products found
because this supplier's products are not listed.
Mikhail Golman, et al.,
bioRxiv - Bioengineering 2021
Quote:
10-week old C57BL6/J mice (n=10/group, Jackson Laboratories) were subjected to two in vivo loading models ...
-
No products found
because this supplier's products are not listed.
Quinton M. Dowling, et al.,
bioRxiv - Bioengineering 2023
Quote:
... in LB (10 g Tryptone, 5 g Yeast Extract, 10 g NaCl) grown in a 10 L BioFlo 320 Fermenter (Eppendorf). At inoculation ...
-
No products found
because this supplier's products are not listed.
Qiuyun Pan, et al.,
bioRxiv - Immunology 2023
Quote:
... with 10% FBS (Atlas Biologicals), 1% penicillin and streptomycin (Gibco) ...