-
No products found
because this supplier's products are not listed.
Kojiro Suda, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were incubated in 98 μl Sorbitol buffer + 2 μl of 2.5 mg/ml Zymolyase 100T (SEIKAGAKU CORPORATION) for 90 min (wild type ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and PFOS (CAS 2795-39-3, purity ≥ 98%) and Perfluoro-3,6,9-trioxadecanoic acid (PFO3DoDA, CAS 151772-59-7, purity 98%) were from Matrix Scientific (Columbia, SC). Nafion byproduct 2 (CAS 749836-20-2 ...
-
No products found
because this supplier's products are not listed.
Yang Sun, Karla Ramos-Torres, Pedro Brugarolas,
bioRxiv - Biochemistry 2022
Quote:
... 4-aminopyridine-d6 (98% deuterium incorporation) was purchased from CDN isotopes. The protium/deuterium exchange reaction was conducted with Biotage® Initiator+ microwave synthesizer ...
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
(±)5-deoxy-strigol (purity >98%) and (±)-orobanchol were purchased from Strigolab (Italy). (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol ...
-
No products found
because this supplier's products are not listed.
Dhaarsini Jaksch, et al.,
bioRxiv - Biochemistry 2023
Quote:
... boiled for 5 min at 98 °C and separated on 10% denaturing urea polyacrylamide gel (SequaGel®, National Diagnostics, #EC-833). Labeled RNA was visualized by autoradiography ...
-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and 2-amino-N-(1-phenylethyl)benzamide (Enamine).
-
No products found
because this supplier's products are not listed.
Chetan Kumar Arya, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and Wizard Classic 1 and 2 (Rigaku Japan). Crystals of DMFase were obtained by mixing 200 nl of protein in buffer A with equal volumes of precipitant ...
-
No products found
because this supplier's products are not listed.
Xiaoqin Zhan, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 0.1 μg/ml MEK1 activated extracellular signal-regulated kinase 1 and 2 (pERK1/2) (SignalChem Biotech), 1 μM TTA-P2 (Alomone Labs) ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... were inoculated separately with a starting OD600= 0.1 or in different ratios (1:1 and 1:10) in Delft medium + 2% beechwood glucuronoxylan (Megazyme, Ireland) for 120 h at RT ...
-
No products found
because this supplier's products are not listed.
Yan Zhang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... at ∼1×105 cells per well in 100 µL of a 1:2 mixture of NbActiv4 (BrainBits) and plating medium (28 mM glucose ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5311-1GM,
1 gram, USD $305.0
Ask
Samuel S. Hinman, et al.,
bioRxiv - Bioengineering 2021
Quote:
... were coated with 2 mL of 10 µg mL-1 human type 1 collagen (5007, Advanced Biomatrix) in 1× PBS (46-013-CM ...
-
No products found
because this supplier's products are not listed.
Jonathon A.B. Smith, et al.,
bioRxiv - Physiology 2024
Quote:
... and glucose uptake was measured in the same medium by adding 1 uL.mL-1 of 2-[1,2-3H]Deoxy-D-glucose (MT911, Moravek) and 10 μM unlabelled 2-Deoxy-D-glucose in for 15 min [32] ...
-
WB, IHC,ELISA
Cat# A5233, SKU# A5233-100ul,
100ul, $157.00
Ask
Joana F. da Rocha, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 μL of 1:10 diluted cDNA was added to 10 μL of 2× SYBR® Green Supermix (Bimake, Houston, Texas, USA) and the final concentration of each primer was 250 nM in 20 μL of total volume ...
-
No products found
because this supplier's products are not listed.
Arun Sharma, et al.,
bioRxiv - Cell Biology 2020
Quote:
... SARS-CoV-2 double stranded RNA (1:100, J2 clone; Absolute Antibody Inc.); cleaved caspase-3 (1:200 ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Caroline Murawski, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 2 µm S1818 (Microchem, 5000 rpm, baking at 100°C for 1 min). Patterns were developed for 40 – 50 s in MF319 (Microchem) ...
-
No products found
because this supplier's products are not listed.
Ana L. Pereira, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... the coverslips were blocked for 1 h at RT with 2% BSA (NZYTech, MB04602), 2% FBS (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Irini Topalidou, et al.,
bioRxiv - Cell Biology 2019
Quote:
Approximately 1-2 × 105 cells per well were plated onto cover slips (Thomas Scientific #121N79) placed in 24-well cell culture plates ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and chicken anti-microtubule associated protein 2 (MAP2, 1:500, EnCor Biotechnology Inc, FL, USA), followed by an incubation (3 days ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... serum was diluted 1/200 and then applied to HEp-2 slides (Antibodies Incorporated or BD). Staining was detected using goat anti-mouse IgG FITC at 1:500 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Iliodora V. Pop, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Mice (1-2 months old) were injected with 4% (w/v) FG solution in saline (Fluorochrome). Mice were anesthetized with isoflurane and the area above and around the cerebellar region was prepared for surgery ...
-
No products found
because this supplier's products are not listed.
Philipp Gaugler, et al.,
bioRxiv - Plant Biology 2022
Quote:
... They were then diluted 1:200 in 2 mL fresh medium supplemented with 6 μCi mL−1 [3H]-myo-inositol (30–80 Ci mmol−1; Biotrend; ART-0261-5) and grown overnight at 28°C in a spinning wheel ...
-
No products found
because this supplier's products are not listed.
Francesca Taglini, et al.,
bioRxiv - Genetics 2023
Quote:
... 2 μl /1×106 cells of the following antibodies were used for immunoprecipitations: H3K4me3 (EpiCypher 13-00041), H3K9me3 (Active Motif 39161) ...
-
No products found
because this supplier's products are not listed.
James R. Occean, et al.,
bioRxiv - Genomics 2023
Quote:
... The sections were blocked for 1 h at room temperature with 2% normal goat serum (Vector Biolabs) then incubated with 2 µg/mL dilution 5hmC antibody (Active Motif ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Hao Liu, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 2-amino-N-(2-aminoethyl)-benzamide (AEAB) was purchased from Chem-Impex International (Wood Dale ...
-
No products found
because this supplier's products are not listed.
Subbaiah Chalivendra, et al.,
bioRxiv - Plant Biology 2020
Quote:
... of the seed meal were extracted with 25 mL 1:1 acetonitrile/water for 2 h on a Model G2 Gyrotory Shaker (New Brunswick Scientific, Edison, NJ, USA). Extracts were filtered with a Whatman 125 mm 2V paper filter (GE Healthcare Bio-Sciences ...
-
No products found
because this supplier's products are not listed.
Tiago Monteiro, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Custom Thermoelectrics) and 1-mm thick probes insulated with 2-mm wide polyimide tubing (95820-13, Cole-Parmer). This was used in tandem with a peristaltic pump (200-SMA-150-050 ...
-
No products found
because this supplier's products are not listed.
Caro-Astorga Joaquin, et al.,
bioRxiv - Microbiology 2019
Quote:
... reduced with 2 μL of 50 mM Tris(2-carboxyethyl) phosphine (TCEP, SCIEX), pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Frank Hidalgo, et al.,
bioRxiv - Biophysics 2022
Quote:
... Peptides were desalted for 4 minutes on a trap column (1 mM ID x 2 cm, IDEX C-128) manually packed with POROS R2 reversed-phase resin (Thermo Scientific 1112906) ...
-
No products found
because this supplier's products are not listed.
Shira Yanovsky-Dagan, et al.,
bioRxiv - Genetics 2019
Quote:
... and then 1–2 μg RNA was reverse-transcribed by random hexamer priming and Multi Scribe reverse transcriptase (ABI). Amplification was performed using the primers ...
-
No products found
because this supplier's products are not listed.
Aarini Ghosh, et al.,
bioRxiv - Zoology 2023
Quote:
Scanning Electron microscope imaging of stridulatory teeth was done at 1–2 kV resolution using JSM-6100 (JEOL, Japan) in the Department of Sophisticated Analytical Instrumentation Facility ...
-
No products found
because this supplier's products are not listed.
Zhipeng Li, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Solution standard: 2 µl of calibration standard #2 (“CEM2”, LGC Standards #VHG-SM70B-100) was added to 200 µl of 50% HNO3 and heated for 2 hrs at 90°C in a loosely capped 15ml centrifuge tube (VWR ...
-
No products found
because this supplier's products are not listed.
Aleksandar Antanasijevic, et al.,
bioRxiv - Immunology 2020
Quote:
... Quantifoil R 2/1 holey carbon copper grid (Cu 400 mesh) were treated with Ar/O2 plasma (Solarus plasma cleaner, Gatan) for 10s before sample loading ...
-
No products found
because this supplier's products are not listed.
Rebecca A. Callahan, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 100 Hz pulse trains (1 ms pulse width) at 2-5 V (A-M systems Isolated Pulse Stimulator Model 2100). Confocal imaging was performed as described above ...
-
No products found
because this supplier's products are not listed.
Nicholas H Harbin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... sections were rinsed in TBS-gelatin and incubated for 2 hours with secondary goat anti-rabbit Fab fragments conjugated to 1.4-nm gold particles (1:100; Nanoprobes, Yaphank, NY) and 1% dry milk in TBS-gelatin to limit cross-reactivity of the secondary antibody ...
-
No products found
because this supplier's products are not listed.
Anna C. Deleray, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 2-hydroxyethyl starch (Spectrum Chemical, H3012) was used.
-
No products found
because this supplier's products are not listed.
Nicholas O. Burton, et al.,
bioRxiv - Genetics 2021
Quote:
... mek-2 and gpdh-2 was synthesized and cloned into the L4440 vector by GENEWIZ (Takeley, UK). Vectors were transformed in E ...
-
LC Laboratories' Product Number C-3987 - Calyculin A, >98% - for research use only. Very potent...
Cat# C-3987, SKU# C-3987_50ug,
50 ug, $124.00
Ask
Nguyen Duy Vuong, et al.,
bioRxiv - Microbiology 2019
Quote:
... 200 µl of sample were prepared: 10,000 spores were resuspended in 198 µL of malt 1 % and 2 µL of rapamycin (LC laboratories, R-5000) were added for treatment or 2 µl of DMSO as mock for control ...
-
No products found
because this supplier's products are not listed.
Yajie Wang, et al.,
bioRxiv - Plant Biology 2022
Quote:
... total RNAs isolated from the leaves of SC8 and mutant lines (#1, #2, #3, #4) using RNAplant Plus reagent (TianGen, Beijing, China) following the manufacturer’s instructions were reversed by using the reverse transcriptase kit (TaKaRa ...
-
No products found
because this supplier's products are not listed.
Darjan Gande, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... at a ratio of 15:1 (see Supplementary Information, 2. for more details) and 10 µL silica magnetic beads (G-Biosciences, USA). The mixture was briefly vortexed and incubated for 20 minutes at room temperature while shaking at 1000 rpm to facilitate DNA binding ...
-
No products found
because this supplier's products are not listed.
Etienne Becht, et al.,
bioRxiv - Immunology 2020
Quote:
... and 2% Armenian hamster serum (Innovative Research) followed by 15min incubation at 4°C ...
-
No products found
because this supplier's products are not listed.
Anna Kirjavainen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 2% Choleratoxin B subunit (#104; List Biological Lab.Inc.) were injected at the speed of 50 nl/min using a microinjector (UltraMicroPump III ...
-
No products found
because this supplier's products are not listed.
Glenn F. W. Walpole, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PtdIns(3,4)P2 (Echelon Biosciences P-3416-2); PtdIns(3,4,5)P3 (Echelon Biosciences P-3916-2) ...
-
No products found
because this supplier's products are not listed.
Yan Jin, et al.,
bioRxiv - Physiology 2024
Quote:
... Mice were given a single 330 μg/kg dose of a synthetic growth hormone releasing peptide-2 (GHRP-2; #OPPA01036, Aviva Systems Biology) by intra-peritoneal (i.p. ...
-
No products found
because this supplier's products are not listed.
Katy Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and mCherry (ThermoFisher #PA534974 at 1:1000; Invitrogen #M11217 at 1:500; PhosphoSolutions #1203-mCherry at 1:10,000). Multiple PDE11A antibodies were utilized to discern the ectopic accumulation of PDE11A4 in ghost axons ...
-
No products found
because this supplier's products are not listed.
Andrea L. Smidler, et al.,
bioRxiv - Bioengineering 2023
Quote:
... We calibrated the model to malaria prevalence data from a randomized-controlled trial of mass drug intervention in the Upper River region (65) by linking MGDrivE 2 (64) to the Imperial College London (ICL) malaria model (103 ...