Labshake search
Citations for GenScript :
1 - 15 of 15 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... recombinant human ACE2-IgG-Fc fragments (r-hACE2-Fc) (GenScript, Z03516) were firstly incubated with the Protein-G agarose (Millipore ...
-
bioRxiv - Immunology 2023Quote: ... and cloned into the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Biophysics 2024Quote: ... CFTR R region-Cterm insert sequences were codon-optimized and ordered from GenScript. CFTR R region-Cterm gene inserts were amplified by PCR and cloned into pET plasmids using Gibson assembly ...
-
bioRxiv - Genetics 2023Quote: The RNase R sequence from Mycoplasma genitalium (accession number: WP_009885662.1) was synthesized by GenScript Biotech Co ...
-
bioRxiv - Microbiology 2020Quote: ... with all lysine residues predicted facing the cytoplasm mutated (TbAQP25K>R) was designed and synthesized by GenScript and verified by sequencing ...
-
bioRxiv - Biochemistry 2024Quote: ... PDZbm cargo peptide 5-HT4(a)R-pS-5 (Phosphorylated at Serine -5 position; commercially synthesized from Genscript) was dissolved in 20 mM Hepes (pH 7.5) ...
-
bioRxiv - Molecular Biology 2021Quote: A construct containing the lysine (K) to arginine (R) mutations within Apl5 PASK cluster was created custom by GenScript and used for the experiments listed in Supplemental Fig 1 and Supplemental Fig 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... An IgG2b expression plasmid encoding the K89/34 IgG2b R-mAb was generated to order by Genscript (https://www.genscript.com/) by replacing the mouse IgG2a (ψ2a ...
-
bioRxiv - Molecular Biology 2020Quote: The EPYC1 full-length gene (encoding amino acids 1-317) and corresponding R/K mutant (EPYC1R64A/K127A/K187A/K248A/R314A) were synthesized by GenScript and cloned between the SacII and HindIII site of the pHue vector48 ...
-
bioRxiv - Immunology 2020Quote: ... Genes for expression of HA fusions to nanoparticle trimeric components were codon optimized for expression in human cells and cloned into the CMV/R (VRC 8400) mammalian expression vector by Genscript. All HA fusions to the I53_dn5B trimer contained full-length HA ectodomains including native secretion signals ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This gene was codon optimized for human cell expression and made in the CMV/R mammalian expression vector by Genscript. Transient transfection into HEK293F cells was carried out using PEI MAX ...
-
bioRxiv - Immunology 2023Quote: ... and were codon-optimized for human cell expression and made in the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Cell Biology 2023Quote: ... and the primers covering SNPs in the Cth (F- GAGCCTGGGAGGATATGAGA, R- AAGCTCGATCCAGGTCTTCA) and Ttc4 (F – GACAGGGCGGAACTATACCA, genes. qPCR products were Sanger sequenced using the GenScript Biotec Sanger sequencing service.
-
bioRxiv - Neuroscience 2023Quote: ... SnifferOT cells were transiently transfected to express the red fluorescent genetically encoded calcium indicator R-GECO (GenScript, Piscataway, NJ, USA) with Fugene HD reagent (Promega ...
-
bioRxiv - Immunology 2024Quote: ... The sequences were codon-optimized for human cell expression and cloned into pCMV/R using the XbaI and AvrII restriction sites by Genscript. The plasmids for hACE2-Fc ...