Labshake search
Citations for GenScript :
401 - 450 of 647 citations for 4' Bromo 3' fluoro 2 morpholinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... RNA-sequencing was applied to confirm the full-length JURV genome (10,993 bp) as previously described.4 Infectious JURV was recovered from a full-length cDNA clone (Genscript, USA) comprising genes encoding for the nucleoprotein (JURV-N) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mouse Meis2 isoform D (4) (the tag was removed) and Lhx6 variant 1 (C-DYK) expressing vectors were purchased from Genscript, Dlx5 and Pbx1 coding sequences were amplified from mouse cDNA and cloned into pcDNA3.1 (Genscript) ...
-
bioRxiv - Immunology 2023Quote: ... The full-length BQ.1.1 S construct containing a 21 amino acid C-terminal deletion was generated by mutagenesis of the BA.4/5 S construct by Genscript.
-
The activator domain of bacterial collagenases drives collagen recognition, unwinding and processingbioRxiv - Biochemistry 2023Quote: The coding sequences of V-B from Scl2.28 incorporating the 4 mutated tripeptides and the coding sequence of the V domain from Scl2.3 were purchased from Genscript (Germany). The modified coding sequence of V-B was cloned into a modified pET15b vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... The supernatant was collected by centrifugation at 120,000g for 60 min at 4°C and then incubated with anti-DYKDDDDK Magnetic Beads (Genscript, L00835) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2023Quote: Pelleted virions were dissolved in SDS-PAGE sample buffer and subjected to electrophoresis on precast 4-20% gradient gels using Tris-MOPS running buffer (Genscript). Proteins were transferred to Protran nitrocellulose membranes (Perkin-Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... 15-30 μg protein were loaded and separated by SDS-PAGE in 4–12% SurePAGE 12-well pre-cast gels (Genscript). Proteins were transferred onto PVDF membranes using iBlot or iBlot2 system (Thermo) ...
-
bioRxiv - Neuroscience 2024Quote: ... denatured for 5 min at 95°C and electrophoresed on a 4-12% Bis-Tris Sure PAGE (GenScript, Piscataway, NJ) with the molecular weight marker (Prime-Step Prestained ...
-
bioRxiv - Molecular Biology 2024Quote: ... [32] Protein purity was confirmed by sodium-dodecyl-sulfate polyacrylamide electrophoresis (SDS-PAGE) on 4-15% gradient gels (Genscript, USA) stained with 0.0025% w/v each of Coomassie® Brilliant Blue G-250 and R-250 in 10% v/v ethanol ...
-
bioRxiv - Immunology 2024Quote: ... Gametocyte extract and 230CMB 21 samples were mixed with 4× NuPAGE™ LDS sample buffer and heated for 10 minutes at 70°C before loading on a 4–20% Bis-Tris gel (GenScript). 20 ng 230CMB was loaded per well and the Precision Plus Dual Color protein marker (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... with pGS-CMAS-Neo plasmid with sgRNA targeting exon 4 of CMAS with CCATCCCAGTCTTGTCGACG gRNA from a U6 promoter and a neomycin-resistance marker (GenScript). Clonal A549 CMAS-deficient cell lines were established by limiting dilution after selection with 800 μg/mL G418 (GeneticinTM ...
-
bioRxiv - Biochemistry 2024Quote: The peptidase activity of the 20S CP was measured using a pair of substrates: the tripeptide benzyloxycarbonyl-Val-Leu-Arg-7-amino-4-methylcoumarin (Z-VLR-AMC, Genscript) and a 11-residue oligopeptide conjugated to 7-methoxycoumarin-4-acetic acid referred to as LF211 (7-methoxycoumarin4-acetic acid (MCA)-Lys-Lys-Val-Ala-Pro-Tyr-Pro-Met-Glu-(dinitrophenyl)diaminopropionyl-NH2 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA ...
-
bioRxiv - Immunology 2021Quote: ... chimeric group 1 or group 2 stalk proteins expressed in Sf9 cells were column purified (GenScript). For functional assays and luminex Fc receptor binding and titer ...
-
bioRxiv - Immunology 2022Quote: ... The gene to express SARS-CoV-2 S2 PentaPro in prefusion conformation was synthetized by GenScript residues 686 to 1211 fused C-terminally to a foldon trimerization domain and His-tagged ...
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of 10 µg SARS-CoV-2 Spike RBD WH-01 protein (GenScript, cat# Z03483), combined with 1 nmol AMP-CpG-7909 (AMP-CpG ...
-
bioRxiv - Microbiology 2020Quote: ... 60 or 100 nM of his/FLAG-tagged SARS-CoV-2 spike protein (GenScript, Z03481-100) was added to each well ...
-
bioRxiv - Immunology 2021Quote: ... human recombinant IL-2 (10 U/well) and with or without NP311 or NP366 peptides (Genscript) at 0.2ug/ml ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 Spike gene from plasmid pUC57-2019-nCoV-S-Hu (GenScript, Piscataway, USA) was truncated in its cytoplasmic tail of 19 amino acids ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA ...
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 spike protein (ECD) and RBD were purchased from GenScript (Piscataway, NJ, USA).
-
bioRxiv - Immunology 2023Quote: ... The supernatant was then incubated with 2-5 ml of FLAG Affinity resin (GenScript, Nanjing, China) for 1 h at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... The synthesis of cDNA encoding SARS-CoV-2 variant Omicron BA.5 was performed by GenScript, Nanjing ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit anti-Akr1B-2 at 1:100,000 (produced to full-length Drosophila p23 (Q9VH95) by GenScript) and mouse anti-α-Tubulin at 1:5000 (AB_477593 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: The above assay was performed using SARS-CoV-2 sVNT ready to use kit by Genscript, which is a competition ELISA (4) ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was applied onto a self-packaged Ni-affinity column (2 mL Ni-NTA, Genscript) and contaminant proteins were removed with wash buffer (50 mM Tris pH 8.0 ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatant was applied onto a self-packaged Ni-affinity column (2 mL Ni-NTA, Genscript) and contaminant proteins were removed with washing buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2024Quote: ... Mice were immunized with SARS-CoV-2 Spike protein (5 µg, Val16-Pro1213, wild type, Genscript) with Alhydrogel® adjuvant 2% (InvivoGen ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stimulated with an overlapping peptide pool derived from SARS-CoV-2 Spike protein (Genscript). Following 2 hours of culture ...
-
bioRxiv - Bioengineering 2024Quote: ... and 35 kPa (7% 20 kDa 8-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript). Flat bottom hydrogels were fabricated by first plasma treating µ-slides 8 well (Ibidi USA ...
-
bioRxiv - Biochemistry 2024Quote: ... The cleared lysate was incubated with 2 ml of MonoRab anti-DYKDDDDK Affinity Resin (L0076; GenScript) for 30 minutes ...
-
bioRxiv - Immunology 2024Quote: ... – BMDC of Pink1−/− mice were stained with Tag-it Violet as described previously and then coated on ice for 3 hours with the mitochondrial peptide pool (custom synthesis by Genscript or Canada Peptide) or mock pool (OVA 257-264 ...
-
bioRxiv - Developmental Biology 2023Quote: ... were also commercially synthesized with 5’EcoRV and 3’SpeI ends and cloned into the pCDNA3.1 vector by Genscript (Genscript USA, Piscataway, NJ). To construct the inducible GR-RFX6 wild type or mutants used in cycloheximide direct target assays ...
-
bioRxiv - Microbiology 2021Quote: ... heated for 8 minutes at 95°C and run on a precast 4-12% Bis-Tris PAGE gel (Genscript, Cat# M00654). Protein was transferred to a nitrocellulose (NC ...
-
bioRxiv - Cell Biology 2022Quote: ... 20-50 μg of protein lysate of each sample was loaded and separated on 4-12% Bis-Tris gels (Thermo Fisher or GenScript) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Blocking buffer was removed and replaced with 20 mL blocking buffer supplemented with 4 μL anti-HIS primary antibody (mAb, mouse, GenScript®) and the blot was incubated overnight at 4°C with agitation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Lysates were mixed with Native-PAGE sample buffer 5X (Beyotime) and subjected to Native-PAGE using ExpressPlus™ 4-12% PAGE Gel (GenScript) and Tris-MOPS-SDS Running Buffer (GenScript) ...
-
bioRxiv - Microbiology 2021Quote: ... active protein fractions were further separated through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; 4%–20% Bis-Tris Gel; GenScript, USA). Proteins in the gel slices were eluted in HEPES-K+ buffer (50 mM ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 μg of protein lysates from each sample were denatured in 4X LDS sample buffer followed by separation on 4–12% gradient SDS PAGE polyacrylamide gel (Genscript, #M00653). Separated proteins on the polyacrylamide gel were transferred to a 0.2 μm PVDF membrane (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: Equal sample concentrations (100 μg of total protein per well) were resolved in 4%–20% electrophoresis gradient gels (Genscript, Cat. M00656) and transferred onto polyvinylidene difluoride (PVDF ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell debris were removed by centrifugation (10,000 x g for 10 min at 4°C) and the supernatant was incubated with 30 μL of protein A/G-coated magnetic beads (Genscript L00277) for 1 hour at 4 °C to remove nonspecifically bound proteins ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to measure total protein content to enable equal loading of protein onto 4-12% precast mini polyacrylamide gels (SurePAGE™, GenScript). Proteins were transferred onto polyvinyl difluoride (PVDF ...
-
bioRxiv - Microbiology 2024Quote: ... An equivalent amount of total proteins was loaded in each lane and resolved on a 15% SDS-PAGE gel or 4-12% SurePAGE™ Bis-Tris gel (Genscript), transferred to nitrocellulose by electroblotting ...
-
bioRxiv - Biophysics 2024Quote: Samples were quenched using 4X non-reducing Laemmli SDS sample buffer (TPpro, Taiwan) and then separated on 4-20% gradient SDS gels (GenScript, USA). Visualization of protein bands was carried out using an iBright FL1000 system (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Biochemistry 2020Quote: Disulfide mutants were designed using the Disulfide by Design 2 software69 and synthetic genes ordered from Genscript.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.617 and B.1.1.7 variant Spikes were codon-optimized and synthesized by GenScript Inc (Nanjing ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 S-2P ectodomain trimer (GenBank: YP_009724390.1, BEI NR-52420) was synthesized by GenScript into pCMV with an N-terminal mu-phosphatase signal peptide and a C-terminal TEV cleavage site (GSGRENLYPQG) ...
-
bioRxiv - Microbiology 2021Quote: The Bma-LAD-2-Renilla reniformis luciferase (Ruc) construct was inserted into a pREN2 vector by Genscript. The predicted signal sequence was removed prior to gene synthesis ...
-
bioRxiv - Biophysics 2022Quote: The full-length E-protein sequence from SARS-CoV-2 (GenBank Accession: NC_045512.2) was purchased from GenScript as a synthetic gene with optimized codon use for expression in Xenopus laevis ...