Labshake search
Citations for GenScript :
101 - 150 of 887 citations for 1 Piperidin 4 yl azetidine 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... A peptide representing the mouse ANGPTL4 amino acids 29-53 (29QPEPPRFASWDEMNLLAHGLLQLGH53) was also synthesized by Genscript) with the same C-terminal-GGGC modification ...
-
bioRxiv - Bioengineering 2024Quote: The sEVs were modified with a 29-amino-acid peptide (YTIWMPENPRPGTPCDIFTNSRGKRASNG; GenScript USA, Inc., NJ, USA), derived from RVG using the previous method.71 DOPE-PEG3400-NHS (dioleoylphosphatidylethanolamine poly (ethylene glycol)3400 N-hydroxysuccinimide ...
-
bioRxiv - Physiology 2022Quote: ... PAR-4 Agonist peptide (RP11529) was purchased from GenScript, Piscataway ...
-
bioRxiv - Cell Biology 2023Quote: ... The recombinant Hsc70-4 protein was produced by GenScript by expression of the recombinant protein with a 6X His tag in E ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human OTUD4 (isoform 4 NP_001352986.1) was purchased from GenScript. Human OTUD4 constructs were cloned without tag or with FLAG-tag into the expression plasmid pcDNA3.1 (Life technologies ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Bioengineering 2020Quote: ... in the presence of varying amounts of argininylglycylaspartic acid (RGD, CGRGDS, 2.0 mM, Genscript, George Town, KY), heparin-binding peptide (HBP ...
-
bioRxiv - Biochemistry 2022Quote: ... A peptide corresponding to the human CRX homeodomain (amino acids 39 to 98) was synthesized by Genscript.
-
bioRxiv - Biophysics 2023Quote: ... Some single amino acid mutants were generated by site-directed mutagenesis and others were purchased synthesized (GenScript).
-
bioRxiv - Immunology 2022Quote: RBD-CompA gene based on previously described amino acid sequence [24] was synthesized and cloned by Genscript in the pcDNA3.4+ vector.
-
bioRxiv - Cell Biology 2024Quote: A E.coli codon optimized DNA fragment corresponding to amino acids 32-442 of RON11 was synthesized (Genscript) and cloned into pMAL vector (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then transfected with 3 μg of CXCR3A plasmids (GenScript, OHU18425C) or CXCR3B expression construct (GenScript ...
-
bioRxiv - Plant Biology 2020Quote: ... coli (Supplementary Table 4) and synthesized by GenScript (Piscataway, NJ). The Arabidopsis THI4 sequence was the native cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Polyacrylamide gel (SurePAGE™, 4-20%) was bought from Genscript Biosciences (Nanjing ...
-
bioRxiv - Microbiology 2022Quote: SDS-PAGE analyses were performed using 4-12% SurePAGE (Genscript), the precast mini polyacrylamide gels ...
-
bioRxiv - Neuroscience 2022Quote: ... The proteins were separated by 4-20% SDS-PAGE (GenScript) and transferred onto PVDF membranes(Amersham) ...
-
bioRxiv - Biophysics 2020Quote: ... and then resolved on 4%-20% Bis-Tris gels (GenScript). The gels were stained with Coomassie brilliant blue and imaged with Image Lab 3.0 (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... Interleukin-4 (catalog #Z02996) was purchased from GenScript (Piscataway, NJ). Reduced glutathione (catalog #G6529 ...
-
bioRxiv - Biochemistry 2024Quote: ... SDS-PAGE (SurePAGE™, Bis-Tris, 10ξ8, 4-12%, GenScript) was used to assess protein purity ...
-
bioRxiv - Cell Biology 2024Quote: Proteins were separated on 4-12% SDS-PAGE gels (GenScript) and transferred to PVDF membrane (0.2 μm ...
-
bioRxiv - Microbiology 2024Quote: Samples were separated on 4-12% Bis-Tris gels (Genscript) in Tris-MOPS-SDS running buffer (Genscript M00138 ...
-
bioRxiv - Immunology 2022Quote: ... A total of 500,000 splenocytes were restimulated ex vivo with the full-length SARS-CoV-2 B.1.1.529 S 15-mer (overlapping by 11 amino acids) peptide pool (GenScript) in plates pre-coated with anti-IFN-γ or anti-IL-4 antibodies ...
-
bioRxiv - Biophysics 2022Quote: ... A 23 amino acid synthetic peptide corresponding to the X-31 FP domain56 was custom synthesized by GenScript, NJ labelled with tetra-methyl rhodamine (Sequence ...
-
bioRxiv - Immunology 2021Quote: 15-mer peptides that are overlapping by 10 amino acids (AA) spanning the entire SARS-CoV-2 Spike protein (GISAID EPI_ISL_410713) were synthesized (Genscript) and pooled into 7 pools of approximately 40 peptides in each pool (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: Fluorescein isothiocyanate (FITC) labeled peptides corresponding to the carboxyl-terminal 10 amino acids of Yhl045w (FITC-RKRVLGVAYL, Genscript) and Idp3 (FITC-YEDKKGMCKL ...
-
bioRxiv - Genetics 2022Quote: The designed 3 pegRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: The 50-residue synthetic peptide used in Figure 3 was synthesized by GenScript USA Inc ...
-
bioRxiv - Genetics 2024Quote: ... 3’ sequence: GTT TTA GAG CTA GAA ATA GCA AGT TAA AAT) (Genscript), amplified with outside primers corresponding to the 5’ constant sequence and the reverse complement of the 3’ constant sequence in 17 cycles using Phusion Polymerase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were separated in 4-20% gradient precast PAGE gels (Genscript) and stained by Coomassie blue.
-
bioRxiv - Microbiology 2022Quote: ... Protein samples were separated by 4– 12% gradient SDS-PAGE (GenScript) and blotted onto nitrocellulose or PVDF membranes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and loaded onto a 4 – 12% gradient SDS-PAGE gel (Genscript) for electrophoresis ...
-
bioRxiv - Systems Biology 2020Quote: ... resolved on a 4-20% gradient ExpressPlus™ PAGE gels (GenScript) and transferred to PVDF membranes (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were loaded on 4–20% polyacrylamide gradient gels (#M42015, GenScript), according to the guidelines of the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... and on 4-20% polyacrylamide gels (GenScript® Express Plus PAGE) in Tris-MOPS-SDS running buffer (GenScript® Running Buffer Powder ...
-
bioRxiv - Cell Biology 2024Quote: ... were separated via SDS-PAGE using 4-12% Bis-Tris (Genscript) in 1X MES Running Buffer (Genscript ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were separated on 4-12% gradient precast SurePAGE gels (GenScript), and subsequently transferred to nitrocellulose membranes (Amersham Bioscience ...
-
bioRxiv - Bioengineering 2024Quote: ... proteins were separated on 4–12% SurePAGE gradient gel (M00725, GenScript), transferred to Immobilon-P PVDF membrane (IPVH00010 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were separated by 4-20% SurePAGE™ Gel (GenScript) for 1 h at 140V and then transferred to PVDF membranes for 2 h at 75V ...
-
bioRxiv - Cell Biology 2021Quote: The following peptides corresponding to the Sst2 amino acid sequence surround Serine 539 were synthesized by Genscript (Piscataway NJ), the phospho-Sst2 S539 peptide LHPHSPLSEC ...
-
bioRxiv - Biochemistry 2020Quote: SARS-CoV-2 nsp12 gene (amino acid 4393-5324 Uniprot: P0DTD1) was synthesized de novo by GenScript (Nanjing, China) and constructed onto pET22b vector between NdeI and XhoI sites ...
-
bioRxiv - Biophysics 2023Quote: ... fused to enhanced yellow fluorescent protein by an 18 amino acid flexible linker (EFC-SRRYRGPGIHRSPTA) was synthesized and cloned into the pcDNA3.1(+) expression vector by GenScript. The Tau4RD*LM-YFP sequence was then subcloned into the pIRESpuro3 vector (Takara ...
-
bioRxiv - Cell Biology 2024Quote: FITC-labeled aminocaproic acid-disulfide-cyclized ACRGDGWCG peptide (FITC-cyclic-ACRGDGWCG) and FITC-labeled aminocaproic acid-GRGDLGRLKK peptide (FITC-proTGFβ3 peptide) were synthesized by GenScript. Preliminary experiments (Supplementary Fig ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The sialic acid synthase protein (NCBI accession # XP_021429200) was commercially produced using the insect expression vector pFastBac1 (GenScript U488UFB180).
-
bioRxiv - Molecular Biology 2023Quote: ... Afp18N20EtA (Afp18N20EtA: MPYSSASKAKATHSKATARD, glutamic acids to alanines) were synthesized and subcloned into pET11a_afp18NT20-casΦ-2 (replacing afp18NT20) by Genscript.