Labshake search
Citations for GenScript :
451 - 500 of 693 citations for 2 Amino 6 chloro 9 3 5 di O p toluoyl beta D 2 deoxyribofurnanosyl purine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... the MERS-S gene in the antigenomic plasmid pVSV*ΔG(MERS-S) was replaced by a modified SARS-CoV-2 spike gene (Genscript, Piscattaway, USA) taking advantage of the flanking MluI and BstEII endonuclease restriction sites ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Immunology 2021Quote: The cDNA of membrane glyco-protein (MGP) and Non-structure protein 13 (NSP13) of ORF1b from SARS-CoV-2 were purchased from Genscript (NJ, USA) and cloned into lentiviral vector pLVX (TAKARA ...
-
bioRxiv - Biophysics 2022Quote: ... the coding sequence for the E protein from SARS-CoV-2 was initially codon optimized for Xenopus laevis and synthesized (GenScript, Piscataway, NJ). The gene was later modified for expression in HEK293 cells by adding a fluorescent EGFP tag ...
-
bioRxiv - Cell Biology 2022Quote: ... Coding sequence of SARS-CoV-2 S gene (GenBank: QHU36824.1) fusion with a c-terminal His tag was synthesized in vitro (Genscript, Piscataway, NJ, USA) after an optimization for expression in human cells.16 The sequence was cloned into a pcDNA3.1 vector to obtain pcDNA-Spike.16
-
bioRxiv - Molecular Biology 2021Quote: The surrogate virus neutralization test (sVNT) assay was performed using the SARS-CoV-2 surrogate virus neutralization test kit (GenScript, NJ, USA). Briefly ...
-
bioRxiv - Pathology 2020Quote: ... Coding sequence of SARS-CoV-2 S gene (GenBank: QHU36824.1) fusion with a c-terminal His tag was synthesized in vitro (Genscript, Piscataway, NJ, USA) after codon optimization for expression in human cells ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific CD4+ and CD8+ T cell responses in NHP PBMCs were assessed by flow cytometry using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 30 °C in YP medium supplemented with adenine and either 2% raffinose (inducible G1 replication system) or 2% glucose (sporadic G1 replication system) and synchronized in G1 by adding α-factor (MPIB core facility or GenScript RP01002) to a final concentration of 0.5 µg/ml for bar1Δ cells or 10 µg/ml for BAR1 cells ...
-
bioRxiv - Microbiology 2020Quote: Detection and semi-quantitation of neutralizing antibodies was determined using SARS-CoV-2 Surrogate Virus Neutralization Test Kit (Genscript, Cat. No.: L00847). Testing of sera was performed as outlined in the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Sample absorbances were compared to the neutralization curve of a commercially available anti-SARS-CoV-2 RCB monoclonal antibody (GenScript, Catalog # A02051) of known concentration to extrapolate antibody titers ...
-
bioRxiv - Immunology 2021Quote: RBD and NP end-point titers were determined using standard ELISA and plates coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) or 1ug/mL SARS-CoV-2 nucleocapsid protein (NP) ...
-
bioRxiv - Immunology 2021Quote: ... Gene encoding Spike of SARS-CoV-2 (GenBank NC_0101080) codon-optimized for human codon usage (GenBank MC_0101081) was purchased from Genscript (pUC57-2019-nCoV-S). RBD was used to generate a fragment encoding RBD-SSGGASVLA linker-recombinant ferritin ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Microbiology 2022Quote: ... Fifteen-mer overlapping peptides from SARS-CoV-2 spike glycoprotein (Cat# PM-WCPV-S-1, JPT peptides, Berlin, Germany) and MeV-nucleoprotein (Genscript, NJ, USA) were used to stimulate splenocytes at 5 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... or by adding 200 ng/well of monovalent or bivalent cAbCMY-2 (254) recognized by 1/2000 diluted rabbit anti-HCAbs antibody conjugated to HRP (Genscript, United States). TMB was used as substrate while reaction was stopped by 1 M H3PO4 ...
-
bioRxiv - Bioengineering 2020Quote: ... for detection of anti-L and anti-D antibodies plates were coated with either L-MMP peptide or D-MMP peptide resepcitvely (GenScript; sequence above) Serum samples were tested at a 1:500 dilution followed by incubation with alkaline phosphatase-labeled goat anti-mouse IgG1 or IgG2a ...
-
bioRxiv - Cell Biology 2022Quote: ... P-factor (TYADFLRAYQSWNTFVNPDRPNL) and α-factor (WHWLQLKPGQPMY) (Custom Peptide Synthesis, 4 mg, ≥95% purity, GenScript Biotech) were dissolved in DMSO to a concentration of 10 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... PDZbm cargo peptide 5-HT4(a)R-pS-5 (Phosphorylated at Serine -5 position; commercially synthesized from Genscript) was dissolved in 20 mM Hepes (pH 7.5) ...
-
bioRxiv - Biochemistry 2020Quote: ... Xanthoxycyclin D and xanthoxycyclin F were purchased from GenScript Inc ...
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Cell Biology 2021Quote: The following peptides corresponding to the Sst2 amino acid sequence surround Serine 539 were synthesized by Genscript (Piscataway NJ), the phospho-Sst2 S539 peptide LHPHSPLSEC ...
-
bioRxiv - Biophysics 2023Quote: ... fused to enhanced yellow fluorescent protein by an 18 amino acid flexible linker (EFC-SRRYRGPGIHRSPTA) was synthesized and cloned into the pcDNA3.1(+) expression vector by GenScript. The Tau4RD*LM-YFP sequence was then subcloned into the pIRESpuro3 vector (Takara ...
-
bioRxiv - Neuroscience 2024Quote: ... human α-synuclein cDNA sequences fused to enhanced yellow fluorescent protein by an 18 amino acid flexible linker (EFCSRRYRGPGIHRSPTA) were synthesized and cloned into the pcDNA3.1(+) expression vector by GenScript. The α-syn140-YFP sequences were then subcloned into the pIRESpuro3 vector (Takara ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The PT334-6 promoter18 was synthesized by GenScript (Nanjing, China) then cloned into pBRT between EcoRI and KpnI sites to yield pBRPt334-6 ...
-
bioRxiv - Biochemistry 2024Quote: sfGFP-Rad51 and yBBR-Rad51 were synthesized as codon-optimized ORFs and engineered into RSF-Duet1 plasmids (Supplementary Figure 9; Genscript Inc.). The sfGFP-Rad51 construct was designed as described29 and the sfGFP was engineered with flanking 16 aa linkers at the 55th amino acid of the Rad51 coding region ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Pathology 2021Quote: ... the recombinant N protein was constructed by inserting the N gene of SARS-CoV-2 into the pGEX-6P vector (GenScript Japan, Tokyo, Japan). Next ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2-specific T cell responses in rhesus macaque PBMCs were assessed by an IFN-γ ELISPOT assay using recombinant SARS-CoV-2 S1 protein (GenScript, Nanjing, China). Ninety-six-well plates (Millipore ...
-
bioRxiv - Immunology 2021Quote: ... The gene encoding the Spike protein of SARS-CoV-2 (UniProt P0DTC2) codon-optimized for expression in CHO cells was synthesized by Genscript (Piscataway, NJ, USA). The optimized DNA fragment was cloned in the expression vector to create pCNeoMEM-S ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 nsp5 was cloned into the pGEX-6P-1 vector using BamHI and XhoI and then synthesized commercially (GenScript, Piscataway, NJ, USA). A native N-terminus is attained during expression through an nsp5 autoprocessing site corresponding to the cleavage between nsp4 and nsp5 in the viral polyprotein ...
-
bioRxiv - Microbiology 2023Quote: We optimized the codon of SARS-CoV-2 spike (S) proteins for improved expression in human cells using GenSmart™ Codon Optimization Tool (GenScript, https://www.genscript.com), and obtained the S gene fragment of Wuhan-Hu-1 strain (GenBank ...
-
bioRxiv - Pathology 2022Quote: ... bat sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay (SARS-CoV-2 sVNT, GenScript, Piscataway, New Jersey) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Serum samples were tested for presence of antibodies against SARS-CoV-2 with the L00847 surrogate virus neutralization test (sVNT) (GenScript cPass™, USA) as described in Mariën et al ...
-
bioRxiv - Immunology 2023Quote: ... Sera were screened at a 1:10 dilution using a competitive enzyme linked immunosorbent assay with the S-RBD horseradish peroxidase (HRP) for Omicron BA.1 (SARS-CoV-2 sVNT L00847-A and S-RBD HRP Z03730, GenScript, Rijswijk, The Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... A protease solution (9.5 ml lysis buffer with 2 mM TCEP and 500 µl His-tagged TEV protease (10KU, Genscript or in-house purified)) was then added to release DDX4N1 CtoA into the solution during over-night incubation at room temperature with gentle mixing ...
-
bioRxiv - Biochemistry 2020Quote: ... All P-Rex2 and PTEN mutations were synthesised and sequence-verified in the same vectors by Genscript. Rac1 (G12V ...
-
bioRxiv - Bioengineering 2023Quote: ... plantarum NCIMB8826 strain harboring helper plasmid pLH01 was induced with 100 ng/ml Sakain P peptide (GenScript) for RecE/T expression and was subsequently prepared as competent cells ...
-
bioRxiv - Synthetic Biology 2022Quote: ... carrying 5’-GCAATGCGTATCATTCTGCT and 5’-GCCGTCAACTTTCGCGTATT guide sequences (from GenScript USA Inc.). Positive colonies were selected by screening colonies with allele-specific PCR (Supplementary Table 4 ...
-
bioRxiv - Immunology 2023Quote: sgRNAs (PD-L1: 5’TCTTTATATTCATGACCTAC; CD155: 5’CCCGAGCCATGGCCGCCGCG) were chemically synthesized (GenScript). Ribonucleoproteins (RNPs ...
-
bioRxiv - Bioengineering 2020Quote: Codon-optimized forms of human ACE2 binding region (amino-acids 19-615) and modified ACE2 genes were chemically synthesized (Genscript), and were subcloned upstream of a human Fc region (derived from IgG1 ...
-
bioRxiv - Biophysics 2021Quote: A plasmid expressing mature OmpA without the 22 amino acid signal sequence in the pET303 vector was purchased from Genscript for cloning of the modified loop constructs ...
-
bioRxiv - Cell Biology 2022Quote: ... (amino acids 571-1255) was synthesized and cloned into modified pET23b vector at the AgeI and NotI restriction sites (Genscript). Purification of 6×His-mDia1(FH1-C ...
-
bioRxiv - Molecular Biology 2020Quote: The EPYC1 full-length gene (encoding amino acids 1-317) and corresponding R/K mutant (EPYC1R64A/K127A/K187A/K248A/R314A) were synthesized by GenScript and cloned between the SacII and HindIII site of the pHue vector48 ...
-
bioRxiv - Biophysics 2020Quote: ... 10 nM NS2B-NS3pro was incubated with the substrate benzoyl-Nle-Lys-Arg-Arg-7-amino-4-methylcoumarin (Bz-nKRR-AMC) (Genscript) at concentrations varying from 2 to 200 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Tmod3 amino acid sequence with locations of peptides (red – Nterm, blue - Cterm) used to custom prepare chicken anti-Tmod3 antibodies (Genscript). A commercial rabbit anti-Tmod3 antibody (Aviva ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: Michaelis-Menten kinetics of pre-SplB mutants were measured with the peptide substrate Ac-WELQ-AMC (Ac: acetyl-; AMC: 7-Amino-4-methylcoumarin, stock concentration: 26 mM in DMSO, concentration range: 13-1161 μM, Genscript) at an enzyme concentration of 125 nM to 2.5 μM using a Tecan infinite 200Pro (excitation wavelength 339 nm ...
-
bioRxiv - Cell Biology 2024Quote: ... (Biotin-GRMTNGAMNVEIGNPTYKMYEGGEPDDG) and LRP1 (NPXA) (Biotin-GRMTNGAMNVEIGNPTAKMYEGGEPDDG) peptides corresponding to human LRP1 amino acid residues 4458-4483 were purchased from GenScript and ...
-
bioRxiv - Cell Biology 2023Quote: The antibody against B55α was generated by immunizing rabbits with a synthetic peptide corresponding to the first 15 amino acids of the N-terminal region of B55α (MAGAGGGNDIQWCFS) conjugated to keyhole limpet hemocyanin (Genscript). The resulting sera were purified with CNBr-activated sepharose 4 Fast Flow (GE Healthcare ...