Labshake search
Citations for Takara Bio :
1 - 44 of 44 citations for L Asparagine H2O 13C4; D3; 15N2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and inserted between SpeI and NotI restriction sites (pFastBac1-hCAP-D3-[3C]-StrepII) by using restriction enzymes and a DNA ligation kit (TaKaRa). To create the hCAP-H2 construct with an N-terminal StrepII-tag (pFastBac-StrepII-[3C]-hCAP-H2) ...
-
bioRxiv - Plant Biology 2024Quote: ... The dilutions were plated on selective -LT medium as a growth control and on -LTH medium (7.6 g/L Yeast Nitrogen Base [YNB], 20 g/L glucose, 0.62 g/L DO supplement -leu -trp -his [Clontech], 15 g/L agar) for the protein interaction assay ...
-
bioRxiv - Biophysics 2021Quote: ... RNA was synthetized using the T7-Scribe transcription kit (Cellscript) and purified with Chroma Spin DEPC-H2O columns (Clontech, CA, USA). The ncAA naphthalene was ligated to the tRNA with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... the supernatant was removed and the pellet was dissolved in 20 ul RNase-free H2O (Takara Bio Inc., Otsu, Shiga, Japan). Quantitation of the RNAs was performed spectrophotometrically at 260 nm ...
-
bioRxiv - Neuroscience 2022Quote: ... Doxycycline (2 mg/L, Clontech) was also included on d0 to induce TetO gene expression by binding to rtTA and the TetO promoter upstream of the Ngn2 gene ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Plant Biology 2024Quote: ... Transformed yeast cells were grown under selective conditions in a minimal medium (46.7 g L-1 Minimal SD Agar Base [TaKaRa], 0.78 g L-1 uracil dropout supplement [TaKaRa]). Cytokinin transport assays were performed according to the method described by Zhao et al ...
-
bioRxiv - Plant Biology 2024Quote: ... 0,77g/L SD-URA drop out mix (Clontech), 0.67 g/L Yeast Nitrogen Base (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.64 g/L DO supplement -leu -trp (Clontech), 15 g/L agar ...
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Plant Biology 2024Quote: ... The clones growing in the –L/-T liquid selection medium (Clontech) were diluted by a 10x series dilution and spotted onto –L/-T/-H medium (Clontech ...
-
bioRxiv - Neuroscience 2023Quote: ... pTIT-P and pTIT-L using Xfect Transfection Reagent (Takara, 631318) according to the instructions of the manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... and 10 μ L SYBR premium ExTaq Perfect Real Time (TaKaRa Bio), adjusted to a final volume of 20 μL with water ...
-
bioRxiv - Cancer Biology 2023Quote: ... Clarified lysate was mixed with ∼0.5 ml/L of culture cobalt resin (TaKaRa) for one hour ...
-
bioRxiv - Biophysics 2020Quote: ... and allowed to bind to cobalt resin (Talon, Clontech; 1 mL bed volume/L culture). The column was washed sequentially with cobalt wash buffer (CoWB ...
-
bioRxiv - Plant Biology 2024Quote: ... were diluted by a 10x series dilution and spotted onto –L/-T/-H medium (Clontech) to determine interactions between the two proteins.
-
bioRxiv - Zoology 2024Quote: ... 10 μ L of TB Green Premix Ex Taq 2 (TliRNaseH Plus) (TaKaRa, Dalian, China), 1 μ L of each primer (10 μ mol/L) ...
-
bioRxiv - Genetics 2021Quote: ... and were routinely cultured on gelatin-coated plates in t2i/L media: NDiff (N2B27) (Takara #y40002) supplemented with titrated 2i (0.2μM PD0325901 ...
-
bioRxiv - Molecular Biology 2022Quote: ... EBIV M/L segment-specific sequences were amplified by PCR including Universal Primer A Mix (Takara), Gene-Specific Primers (GSPs ...
-
bioRxiv - Microbiology 2024Quote: ... and L gene open reading frames (ORF) were amplified with PrimeSTAR® Max DNA Polymerase (TAKARA) and ligated between the NcoI and BamHI sites of the pTM1 vector with In-Fusion® Snap Assembly Master Mix (TAKARA ...
-
bioRxiv - Cancer Biology 2022Quote: ... gDNA from all cells were isolated using the Machery Nagel L Midi NucleoSpin Blood Kit (Clontech, 740954.20). Modifications to the manufacturer’s instructions were added as follows ...
-
bioRxiv - Microbiology 2024Quote: ... and the protein was purified using cobalt affinity resin (1mL/L culture, Takara Bio USA, San Jose, CA). The protein was washed with 100 mM NaCl ...
-
bioRxiv - Microbiology 2021Quote: ... Thirty-five cycles of L reaction with 0.4 mM barcoded TprK forward and reverse primers (S1 Table) using the 2x CloneAmp MasterMix (Takara) with a 62°C annealing temperature ...
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl of cell extract was used in a buffer containing final concentrations of 52 mM HEPES pH 7.4 (Takara), 35 mM KGlu (Sigma) ...
-
bioRxiv - Plant Biology 2024Quote: ... Transformed yeast cells were grown under selective conditions in a minimal medium (46.7 g L-1 Minimal SD Agar Base [TaKaRa] ...
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of each common amplicon were pooled and gel purified from a 1.5% agarose gel (Nucleospin clean-up, Takara Bio), eluting in 35 μl 10 mM Tris-HCl ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... transformants containing the desired plasmids were screened on a selective dropout (SD) medium lacking tryptophan (W) and leucine (L) (Clontech). Protein interactions were assessed on SD selection medium lacking LW ...
-
bioRxiv - Developmental Biology 2024Quote: ... CRISPR-targeted regions in marcks.L/S and marcksl1.L/S were PCR-amplified using the EmeraldAmp GT PCR Master Mix (Takara Bio). For every gene ...
-
bioRxiv - Microbiology 2024Quote: ... pRF vectors with chimeric L-segments were constructed by in-fusion high-fidelity (HD) restriction-free cloning method (TaKaRa Bio). Two nucleotides of LF2384 L gene were different from those of parent wildtype virus and one nucleotide of LF2350 GPC gene of was different from that of wildtype one ...
-
bioRxiv - Plant Biology 2024Quote: ... and one of 15 µl purified DNA was used for real-time PCR amplification using SYBR Premix Ex Taq II (Tli RnaseH Plus) (TaKaRa) and Real-Time LightCycler 480 system (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Plant Biology 2023Quote: ... were used to co-transform yeast strain AH109 and colonies carrying both vectors were selected on SD medium without tryptophan (-W) and leucine (-L) (TaKaRa 630317) at 28°C ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Biochemistry 2022Quote: ... S domains and variants were purified similar to S protein using nickel resin (10 mL/L, His60 Ni2+ superflow resin, Takara cat# 635664) with wash buffer (25 mM MES ...
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Immunology 2023Quote: ... and used to generate Illumina-ready heavy and light chain sequencing libraries using the SMARTer Mouse BCR IgG H/K/L Profiling Kit (Takara, Cat# 634422). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: ... and 0.5 µl used as a source of genomic DNA in 20 µl PCR reactions with PrimeStar Hot Start DNA polymerase (Takara Bio, R010A). Amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: ... The reaction was performed in a 20 µl reaction mixtures comprising 10 µl of 2×TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (Cat. no. RR420A, TaKaRa), 1 µl of cDNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... pDUP50M1 or pDUP51-ΔM and pDUP50-ΔM (a kind gift from D. L. Black, UCLA, USA) and pCMS-EGFP (Takara Bio USA, Inc) or pEGFP-IQGAP1 (Ren et al. ...