Labshake search
Citations for Takara Bio :
351 - 400 of 638 citations for 6 Benzyloxy 1H indole 2 boronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Plant Biology 2022Quote: ... bHLH39-1 and bHLH39-2 fused to the BD were co-transformed into yeast Y2HGold (Clontech). Transformants were grown on SD-Leu-Trp plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatant was collected 2 days post-transfection and concentrated using Lenti-X lentivirus concentrator (Clontech). Cells were then infected with the concentrated lentivirus ...
-
bioRxiv - Plant Biology 2024Quote: ... The 20-ml reaction mixture contained 10 ml of 2× TB Green Premix Ex Taq (Takara), 2 ml of diluted complementary DNA (1:5) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pM ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 ng of RNA was mixed with 2 μl of PrimeScriptTM RT reagent kit (TaKaRa, RR037B) and distilled water (DW ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The supernatant was applied to 2 mL slurry of TALON Metal Affinity Resin (Takara Bio #635504) and nutated for 1 hour to allow TALON to bind the His tagged protein ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was amplified from WT genomic DNA by PCR using Advantage 2 Polymerase (#639202, Takara Bio, USA). Plasmid backbones were double-digested with the necessary restriction enzymes and purified using the Qiagen DNA purification kit (#28704X4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 50% fresh RPMI medium supplemented with 20 U/ml IL-2 and spin-fected on RetroNectin (Takara)-coated plates at 3000 g at 32°C for 2 h ...
-
bioRxiv - Physiology 2021Quote: ... 2 µL of the synthesized cDNA was mixed with SYBR Premix Ex Taq II (Takara Bio Inc.) and 0.4 µM primers (same as above ...
-
bioRxiv - Molecular Biology 2022Quote: ... the JAK3 open reading frame was amplified by PCR using the Advantage 2 polymerase mix (Takara Bio) with JAK3-ORF primers (Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... Make Your Own “Mate & Plate™” Library System and Yeast Transformation System 2 were purchased from TaKaRa. Synthetic-defined (SD ...
-
bioRxiv - Immunology 2021Quote: ... Synthesis of cDNA was performed by using 2 μg of total RNA with PrimeScriptTM Reverse Transcriptase (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Immunology 2021Quote: ... wild-type SARS-CoV-2 RBD was purified using a 5 mL HisTALON superflow cartridge (Takara Bio) followed by size exclusion chromatography using a Superdex 200 10/300 GL column pre-equilibrated in 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Cell Biology 2022Quote: ... full-length GIP-2 cDNA with a C-terminal V5-His6 tag was inserted into pColdI (TAKARA) and used to inoculate rabbits and rats ...
-
bioRxiv - Cell Biology 2023Quote: ... Yeast 2-hybrid (Y2H) analysis was performed using the protocols described in the Yeast protocols handbook (Clontech, Protocol No ...
-
bioRxiv - Genomics 2022Quote: ... and 2 µl of the reaction was transformed into 25 µl of Stellar chemically competent bacteria (Takara).
-
bioRxiv - Bioengineering 2024Quote: ... Viral genome number was quantified by real-time PCR with AAVpro Titration Kit Ver.2 (Takara, 6233) according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplification was performed using the Advantage 2 Polymerase Mix (Clonetech, now Takara Bio USA, Mountain View, CA) and the following primers ...
-
bioRxiv - Biochemistry 2023Quote: ... The virus particles were further concentrated at 10X in volume using Lenti-X-concentrator (Clontech, PT4421-2) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... Retrovirus was centrifuged for 2 hrs at 2560rcf at 320C onto wells pre-coated with RetroNectin (Takara). Wells were rinsed with PBS and CD8 T cells were added at 1×106 cells/mL in complete RPMI supplemented with 50 U/mL IL-2 and mouse T-activator Dynabeads (ThermoFisher ...
-
bioRxiv - Genomics 2022Quote: ... and 2 µl of the reaction was transformed into 25 µl of Stellar chemically competent bacteria (Takara). Plasmid minipreps were performed using the NucleoSpin Plasmid Transfection-grade Mini kit (Macherey-Nagel ...
-
bioRxiv - Immunology 2022Quote: ... The NTD domain was purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Microbiology 2024Quote: ... bfp and Pbdhfr 3’UTR gene sequences were amplified from plasmids Pb_MH21 and R6K-GW-BFP (PL_HC_001) respectively using Advantage 2 Polymerase Mix (TaKaRa). Individual fragments were assembled by stitch PCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... Six-well plates were coated with retronectin (50 µg/2 mL/well, (Takara Bio Inc., Kusatsu, Japan)) for 16 h ...
-
bioRxiv - Biochemistry 2024Quote: ... His-tagged ectodomain was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON) plus 18 µl 1 M CoCl2 to compensate for cobalt leaching away with the Expi293 Expression Medium ...
-
bioRxiv - Cell Biology 2020Quote: ... SLD3 and ESA1 ORF were PCR-amplified with Taq polymerase (MightyAmp ver. 2, Takara Bio Co., Otsu, Japan) and cloned into the BamHI sites of the Y2H DB vector pST1667 and the Y2H AD vector pST548 (Tanaka ...
-
bioRxiv - Cell Biology 2020Quote: ... transformed with pGEX-4T-2-Bbs5-WT in the presence of 0.1 mM isopropyl-β-D-thiogalactopyranoside (Takara). The proteins were purified with the glutathione-Sepharose 4B protein chromatography purification kit (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2020Quote: Freshly harvested sorted LT-HSCs were starved in PBS for 2 hours and then fixed onto RetroNectin (Clontech)-coated slides ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2020Quote: ... cell content was ejected onto 1.1 µl drop of lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 µg of total RNA was subsequently reverse transcribed to cDNA using PrimeScript RT Master Mix (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 μg of RNA was reverse transcribed in a 20 μL volume with RT PCR master mix (TaKaRa) as per the manual instruction ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed using gene-specific primers (Table 2) and TB Green Premix Ex Taq (Takara). Levels of gene expression were normalized to that of 16S rRNA and expression was assessed for each biofilm and each timepoint relative to its planktonic counterpart using the 2−ΔΔCt method (43).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Yeast 2-hybrid library screening was conducted using the Matchmaker Gold Yeast Two-Hybrid System (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
bioRxiv - Microbiology 2020Quote: ... The qPCR reaction system consisted of 12.5 μL of 2 × SYBR Premix Ex TaqTM II (Takara, Dalian, China), 0.5 μL of upstream and downstream primers (10 mM) ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...
-
bioRxiv - Genomics 2021Quote: ... Long range PCR was performed using Advantage 2 Polymerase following the manufacturer’s protocol (Clontech Laboratories, Mountain View CA).