Labshake search
Citations for Takara Bio :
201 - 250 of 987 citations for Diethyl 2 chlorothiazol 5 yl methylphosphonate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Genomic recombination assay was performed using PCR primers that flank exons 4-6 of mouse Galnt2 (F: 5’-GTACGTGAGACAGGCCTAAGG-3’ R: 5’-CAAGCTTCATTTAGGACCAAGC-3’) and EmeraldAmp PCR Master Mix (Takara Bio, San Jose, CA). PCR cycling parameters were as follows ...
-
bioRxiv - Immunology 2020Quote: ... and mCherry was amplified from pTRE-Dual2 (Clontech # PT5038-5). pAF137 was constructed by amplifying the devil 41BB extracellular domain with primers pAF137-1.FOR and pAF137-1.REV and amplifying mCherry with pAF137-2a.FOR and pAF137-2.REV (Table S3-4) ...
-
bioRxiv - Plant Biology 2021Quote: ... After addition of 5 μL of TransIt transfection reagent (TaKaRa), the mixture was allowed to sit for an additional 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL ExTaq DNA polymerase (5 U/μL; Takara Bio), 40 ng of template DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... roughly 5 million AAV pro293T cells (Takara, San Jose, CA) in 30 mL of media were seeded overnight in a T175 flask (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2020Quote: ... cloned into the vector pAcGFP-N1 (Clontech plasmid PT3716-5), using transfection FuGENE HD® reagent at a ratio 5:1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 5’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... the SCD medium was supplemented with 5 μM AureobasidinA (Clontech), diluted from a 5 mM stock solution (in ethanol ...
-
bioRxiv - Genetics 2022Quote: ... 5 units of Takara LA Taq (TaKaRa Bio USA, Inc.) and 1 μL of 100 μM PacBio universal primer ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5% foetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL−1 penicillin and 10 μg mL−1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2023Quote: ... with 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL-1 penicillin and 10□μg mL-1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2024Quote: ... and 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) along with 10 U ml−1 penicillin and 10 μg ml−1 streptomycin (Pen-Strep ...
-
bioRxiv - Pathology 2021Quote: ... The number of SARS-COV-2 copies were quantified using Direct One-Step RT-qPCR Mix for SARS-CoV-2 kit (Takara Bio Inc.).
-
bioRxiv - Neuroscience 2022Quote: ... and 2 μg/ml Doxycycline (Clontech; Cat. No. 631311). iTF-iPSCs were counted and seeded onto double coated plates (Poly-D-Lysine-precoated Bio plates (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 ug/mL doxycycline (Clontech, Cat. No. 631311). i3Neurons were then fed three times a week by half media changes ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 2 μL of 5X SMARTScribe RT buffer (Takara), 0.5 μL of 100 mM DTT (Millipore Sigma) ...
-
bioRxiv - Zoology 2021Quote: ... 10 μL of 2×SYBR Green Premix (Takara, Japan), and 6.8 μL ddH2O ...
-
bioRxiv - Microbiology 2021Quote: ... followed by selection with 2 μg/ml puromycin (Clontech). (For the sequences of shSIRT6 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 2× SYBR Green qPCR Mix Kit (TaKaRa, Japan) and the cDNA concentration and primers described above were used ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the Advantage® 2 PCR Kit (Takara Bio) in a touchdown cycling program as follows ...
-
bioRxiv - Immunology 2022Quote: ... before amplification using the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Bioengineering 2023Quote: ... quantified via qPCR (AAVpro Titration Kit version 2; Clontech), and stored at 4°C until use.
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Immunology 2023Quote: ... before whole transcriptome amplification using Advantage 2 Polymerase (Clontech) using oligos that introduce Illumina Nextera Multiplex Identifier (MID ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and transferred to a 2 mL gravity column (Takara). The end-cap of the column was removed to drain the buffer and 500 uL of wash buffer was added to wash the resin once more ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neurons were fed on day 6 during a half-medium change and collected on day 7 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). N2 medium was changed once a day for two more days ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: The assay was performed using the 5’-Full RACE kit (TaKaRa) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... coli BL21 and purified on 5 mL Talon column (Clontech®) loaded with Cobalt ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysate was incubated with 5 mL TALON beads (Takara Bio), washed with 150 mL lysis buffer and eluted in 22 mL of elution buffer (25 mM Hepes pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and deoxyribonuclease I (DNase I, 5 units/mL, Takara, Shiga, Japan) for 15 min ...
-
bioRxiv - Immunology 2021Quote: ... 5’ RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech). IgG /IgK/IgL NGS libraries were made by using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µL of the ligation mix (Takara Ligation Kit 6023), and then placing the tubes into a heat block at 90 °C for 15 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the human herpes simplex virus 5 puromycin resistance marker (Clontech).
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... Supernatants were loaded on 5 mL of TALON beads (Takara Bio) pre-equilibrated with the lysis buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with D/D-Solubilizer (5 μM, Clonetech/Takara) and Cycloheximide (35.54 μM ...
-
bioRxiv - Immunology 2024Quote: 5’RACE-ready cDNA was generated using the SMARTer kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 5 U/µL Ex Taq polymerase (Takara Bio, Kusatsu, Shiga, Japan), 20 mg/mL BSA (Roche Molecular Diagnostics ...
-
bioRxiv - Microbiology 2021Quote: ... The extracellular SARS-CoV-2 RNA in the culture supernatant was analyzed using SARS-CoV-2 direct detection RT-qPCR kit (RC300A; TaKaRa-Bio, Shiga, Japan). The infectivity of SARS-CoV-2 in the culture supernatants was determined at 48 h post-infection ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-E-Cad 1:200 (M108, clone ECCD-2, TaKaRa), anti-Nanog 1:200 (eBIO-MLC51) ...
-
bioRxiv - Developmental Biology 2021Quote: ... filtered and concentrated by Lenti-X Concentrator (Clontech, PT4421-2) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with 20ul mixed concentrations of 2 × ExTaq buffer (Takara, Japan), 0.8ul of each forward and reverse primer (10uM) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2 μg of pEGFP-C1 (Takara Bio, Shiga, Japan), together with 0.5 μg of expression plasmid for bcl-xl ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μL of 2× One Step RT-PCR buffer (TaKaRa), and 5 μL ddH2O ...