Labshake search
Citations for Takara Bio :
701 - 750 of 1070 citations for 2 Trimethylsilyl Furo 3 2 B Pyridine 6 Carbaldehyde since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were seeded in one well of a 6 well plate in supplemented DEF-CS (Takara). After a recovery period of 5 days ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Concentrated virus was plated on non-TC treated 6-well plates coated with retronectin (Takara T100B), and spun for 90 minutes at 1200xg ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Site-directed mutagenesis in GC-A and GC-B and construction of chimeric receptors were performed through use of the In-Fusion HD plus cloning kit (Takara Bio Inc.). The primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Plant Biology 2023Quote: ... The resulting fragments were cloned into vector backbones derived from pPY22 (mNeonGreen-Hygromycin B) or pPY23 (mNeonGreen-Nourseothricin) using the In-Fusion Snap Assembly Kit (Takara, cat. 638948). For PpREN knockout ...
-
Mice generated with induced pluripotent stem cells derived from mucosal-associated invariant T cellsbioRxiv - Immunology 2023Quote: ... and resultant RNAs (10 ng per sample) were subjected to cDNA library construction (SMARTer Mouse TCR a/b profiling kit, Takara Bio, Japan). The next generation sequencing was performed with MiSeq (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: Ad vectors were constructed using Adeno-XTM Adenoviral System 3 (Takara Bio). The ACE2 and TMPRSS2 genes were amplified by PCR using cDNA generated from Pulmonary Alveolar Epithelial Cell Total RNA (ScienCell Research Laboratories ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the primers described previously(6) and cloned into pmCherry-C1 (Takara Bio Inc., San Jose, CA). To silence HNRNPK expression ...
-
bioRxiv - Genetics 2022Quote: ... then combined with 6 µL cDNA and 15 µL Mighty Mix T4 DNA ligase reaction mix (Takara) and incubated overnight at 16 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Aliquots of total RNA (1 μg) were reverse transcribed using pd(N)6 random primer (Takara Bio) and Moloney murine leukemia virus (M-MLV ...
-
bioRxiv - Microbiology 2020Quote: ... Cellular RNA was isolated at 6 hpi using the CellAmp Direct RNA Prep Kit (3732; Takara, Japan). The RNA was then diluted in water and boiled ...
-
bioRxiv - Synthetic Biology 2024Quote: ... a non-TC treated 6 or 12-well plate was coated with 20 ug/mL Retronectin (Takara) in PBS and incubated at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... per recipient CFUs and confirmed the transconjugants by PCR detection of vanA and erm(B) genes,22,23 and by SmaI-PFGE (Takara Bio Inc., Shiga, Japan).24
-
bioRxiv - Immunology 2024Quote: ... 2.5 ml of retroviral supernatant was transferred to a non-treated 24-well plate pre-coated with RetroNectin reagent (Takara cat# T100A/B) and centrifuged at 2000 g at 4°C for 2 hours to transduce T cells ...
-
bioRxiv - Immunology 2024Quote: ... 200ng RNA from antigen induced or unstimulated PBMCs was subjected for preparing TCR cDNA libraries by using the SMARTer Human TCR a/b Profiling Kit (Takara Bio USA, Inc). The kit utilizes SMART technology (Switching Mechanism At 5’end of RNA Template ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 1/3 (v/v) of LentiX™ Concentrator reagent (Clontech, Mountain View, USA) was added and incubated overnight (o/n) ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Microbiology 2023Quote: ... HIV-1 NL4-3 Vpu ORF was cloned into pEGFP-N1 (Clontech, France). The ORF of human ATG5 was cloned in frame with HA tag into pAS1B vector (pAS1B-HA-ATG5) ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 800 ng RNA was used with the SMARTer RACE 5’/3’ kit (Takara) following manufacturer instructions ...
-
bioRxiv - Physiology 2024Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... concentrated lentivirus was added to non-TC treated 6-well plates which were coated with retronectin (Takara #T100B) according to manufacturer’s instructions and spun at 1200 x g for 90 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... we combined 494 μL of internal solution with 6 μL of recombinant RNase inhibitor (1 U/μL, Takara) in order to increase RNA yield ...
-
bioRxiv - Neuroscience 2020Quote: ... We coated 6-8 mg of 1.6 µm gold beads with 10-15 µg of EGFP-N1 (Clontech) or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al. ...