Labshake search
Citations for Takara Bio :
451 - 500 of 2347 citations for 3 Piperidinol 1 methyl 4 2 4 6 trimethoxyphenyl cis + since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 800 ng RNA was used with the SMARTer RACE 5’/3’ kit (Takara) following manufacturer instructions ...
-
bioRxiv - Physiology 2024Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were FACS-sorted on a Becton Dickinson FACS Aria cell sorter gating for DAPI−/DRAQ5+/GFP+ cells directly collected in 100 μl of RA1 lysis buffer with 2 μl tris(2-carboxyethyl)phosphine (TCEP) from NucleoSpin RNA XS kit (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and HBS1-R (BamHI)] and HBS1 [using primers HBS1-2-F (NdeI) and HBS1-2-R (BamHI)] were amplified and subcloned into pGADT7 vectors (Clontech). Bait and prey plasmids were co-transformed into the yeast strain AH109 according to the manufacture’s introduction (Clontech) ...
-
bioRxiv - Microbiology 2023Quote: ... The nine fragments of SARS-CoV-2 and the UTR linker for SARS-CoV-2 were prepared by PCR using PrimeSTAR GXL DNA polymerase (Takara). After gel purification of the fragments ...
-
bioRxiv - Bioengineering 2020Quote: ... concentrated lentivirus was added to non-TC treated 6-well plates which were coated with retronectin (Takara #T100B) according to manufacturer’s instructions and spun at 1200 x g for 90 min at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... We coated 6-8 mg of 1.6 µm gold beads with 10-15 µg of EGFP-N1 (Clontech) or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... using Yeastmaker™ Yeast Transformation System 2 (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.5 μL Advantage 2 DNA Polymerase (Takara). Thermocycling conditions were as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 2 µg/ml doxycycline (Clontech, 631311) for 3 days prior to electroporation and to induce Cas9 nickase expression ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μL of T7 Enzyme Mix (TaKaRa). This was adjusted to 30 μL with nuclease-free ddH2O before incubating the mixture at 42°C for 2 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 ul recombinant RNase inhibitor (Takara, 2313B). Isolated nuclei were sorted on a MA900 Multi-Application Cell Sorter (Sony Biotechnology) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μl of cloning enhancer (Takara-bio Inc.) was added to 5 μl of PCR reaction volume to remove the original plasmid ...
-
bioRxiv - Plant Biology 2022Quote: ... using Yeastmaker™ Yeast Transformation System 2 (Clontech). Transformants were grown on minimal synthetic defined (SD ...
-
bioRxiv - Immunology 2023Quote: ... Kit Advantage 2 PCR Enzyme System (Clontech, 639206), QIAquick Gel Extraction ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of PrimeSTAR GXL DNA polymerase (Takara), 200 uM of each dNTP ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μg/ml doxycycline (Clontech, cat. no. 631311), 1X N2 supplement (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μg/ml doxycycline (Clontech, cat. no. 631311), 1X N2 supplement (Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µg/mL doxycycline (Clontech; Cat. No. 631311), and 50 nM TMP (MP Biomedical ...
-
bioRxiv - Microbiology 2024Quote: ... 2 U/µl of Ribonuclease Inhibitor (Takara Inc), 20 ng/µl of plasmid DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... The dialyzed fraction was mixed for 3 h with Talon Metal Affinity Resin (Clontech) that had been equilibrated with Buffer T ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmids were co-transformed pairwise into AH109 yeast strains (Matchmaker 3 System, Clontech), and selected initially on double drop-out (DDO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 14-3-3γ CDS was amplified by PCR and subcloned into pCMV-mCherry (Clontech). Deletion and point mutations of SMAUG1 were created using Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: Y2H assays were performed with the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio). Saccharomyces cerevisiae strain AH109 was co-transformed with different pairs of pGADT7 and pGBKT7 harboring IREH1 or B1-Rafs ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNAs were cloned using the SMARTer RACE 5’/3’ Kit (Takara, Cat No. 634858) and then sequenced (Beijing Genomics Institution ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was harvested from iNs 3 weeks post-induction (Takara Bio catalog #740971) and converted into cDNA using SuperScript IV VILO (Thermofisher Scientific #11756050) ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 105 tumor cells in 6-well culture vessels were transfected with 5 μg DNA using XFect (Takara, Kusatsu, Japan) and clones were selected by puromycin (2-10 μg/mL).
-
bioRxiv - Cancer Biology 2020Quote: LNCaP cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pEmCherry-C2 NTF2 (pDL23) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Samples containing the thereby secreted [His]6-tagged VHH-HlyA fusions were next passed through Talon CellThru resin (Clontech). For this ...
-
bioRxiv - Immunology 2021Quote: ... Retroviral supernatants were loaded by centrifugation (2,000xg for 2 hours at 30°C) onto non-tissue culture treated 6-well plates pre-coated with RetroNectin (20μg/mL; Takara). Activated T cells were added and spin-transduced for 30 minutes at 1,000xg ...
-
bioRxiv - Cancer Biology 2020Quote: WM983B cells were seeded into 6-well plates and transfected at 70% confluency using Xfect Transfection Reagent (#631317, Clontech) with 5 µg of pTetOne NTF2 (pDL66 ...
-
bioRxiv - Microbiology 2022Quote: ... Isolated RNA or serial ten-fold dilutions of RNA standards for the ORF1ab amplicon (ranging from 2.25×10^6 to 250 copies/rxn) were reverse transcribed using the Takara Prime Script RT kit (Takara) using poly(A ...