Labshake search
Citations for Evrogen :
1 - 26 of 26 citations for 6 Quinoxalinamine N 3 8 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... TagRFP fragment without start codon was obtained by PCR with TagRFP-woATG-F 5’-GT CGGTACCGTGTCTAAGGGCGAAGAGCTG-3’ n BFPX3-R 5’-GCGCTTAAGTTAATTAAGCTTGTGCCCCA-3’ primers and pTagRFP-N vector (Evrogen) as a DNA source ...
-
bioRxiv - Microbiology 2021Quote: ... pTAG-BFP-N (Evrogen, FP172) was used.
-
bioRxiv - Molecular Biology 2021Quote: ... or TagGFP2 (pTagGFP2-N vector, Evrogen) were used as controls for the crosstalk of the TagGFP2 signal into the red channel and the Katushka signal into the green channel ...
-
bioRxiv - Cell Biology 2023Quote: ... with BFP from pTagBFP-N Vector (Evrogen) at EcoRI/XbaI) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and cloned into TagRFP-AS-N vector (Evrogen). The SsPrx03 and SsPrx03m1-TagRFP C-terminal fusion was then subcloned (LR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR product and vector pTurboGFP-N (Evrogen) were digested with XhoI and HindIII purified and ligated to generate pGADD34-TurboGFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells expressing either Katushka (pTurboFP635-N vector, Evrogen) or TagGFP2 (pTagGFP2-N vector ...
-
bioRxiv - Microbiology 2019Quote: ... the TagGFP2 sequence of the pTagGFP2-N vector (Evrogen) was amplified via PCR (5’-ATAAGAATTCCGGAATGAGCGGGGGCGAGGAG and 5’-CGGGGAATTCCATATGTTACCTGTACAGCTC primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Red fluorescent protein expression vector pTagRFP-N were from Evrogen, Moscow ...
-
bioRxiv - Developmental Biology 2022Quote: ... mKate2 was amplified from the pmKATE2-N plasmid from Evrogen introducing flanking B2 and BamHIXhoI-B3 sequences and cloned into pGEM-T Easy ...
-
bioRxiv - Developmental Biology 2023Quote: ... the TagCFP DNA fragment was amplified from pTagCFP-N (Evrogen) by PCR with the primers 5′-GAAGATCTATAACTTCGTATAGCATACATTATACGAAGTTATACCGGTCGCC ACCATGAGCG-3′ and 5′-CCGGAATTCCGGATCCATAACTTCGTATAATGTATGCTATACGAAGTTATACCACAACTAGAATGCAGTG-3′ ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into Gateway® TagRFP-AS-N entry clone (Evrogen). The PRX62-TagRFP fusion was subcloned (Gateway Technology ...
-
bioRxiv - Microbiology 2020Quote: ... The fragment encoding tagRFP was PCR-amplified from pTagRFP-N (Evrogen). The fragments of ftsZ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... mIBP83 fragment of pEX-A2-SBP-T plasmid was subcloned into pTagGFP2-N vector (Evrogen) by PCR with the primers
-
bioRxiv - Plant Biology 2020Quote: Amplification of TALE genes was performed via a two-step PCR process in conjunction with primers 5’-GATCCCATTCGTTCGCGCACACCAAGTC-3’ and 5’-CTCCATCAACCATGCGAGCTCCTCTTCG-3’ and Taq DNA polymerase (Evrogen, Russia) under the following conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti-Tag(CGY)FP (1:2000 in 0.5% milk TBST, 4°C o/n, Evrogen AB121). Blots were then incubated with IRDye 800/680 conjugated antibodies (1:10000 in 5% milk TBST ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cytosolic expression was facilitated by expression of free Padron2 inserted into the TagRFP-N vector (Evrogen, Moscow, Russia) with enzymes AgeI and NotI ...
-
bioRxiv - Cell Biology 2022Quote: ... EB1-TagRFP was generated by PCR amplification from KAZUSA cDNA (NCBI AB463888) and inserted into pTagRFP-N (Evrogen). The shRNA target sequence was designed for protein knockdown using the BLOCK-iT RNAi Designer tool (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... VE-cad constructs were subcloned between BamHI and AgeI restriction sites in Gateway TagRFP-AS-N (Evrogen, Farmingdale, NY), in-frame with monomeric C-terminal RFP ...
-
bioRxiv - Cell Biology 2019Quote: ... and SacI/PstI for the pTag-BFP-N to obtain pLEA-BFP (all plasmid backbones were from Evrogen, Milano, Italy). Correct clones were confirmed by Sanger sequencing using ABI PRISM 3100 (Applied Biosystem).
-
bioRxiv - Neuroscience 2020Quote: The caldendrin-tagRFP constructs were made by amplifying full length or caldendrin fragments from the pcDNA3.1/caldendrin vector and pasting them into the tagRFP-N plasmid (Evrogen, #FP142) using EcoRI and BamHI restriction and ligation.
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: 3) The coding sequence of the Tag-BFP (from pTag_BFP-Actin, Evrogen) borded with 2 XhoI sites ...
-
bioRxiv - Plant Biology 2024Quote: ... except for the PCR fragments to make the proLecRK-I.9::LecRK-I.9::tagRFP and the proLecRK-I.9::LecRK-I.9Δkinase::tagRFP constructs which were inserted between the EcoRI and BamHI sites of the Gateway® tagRFP-AS-N entry vector (Evrogen, Moscow, Russia). After each transformation of Escherichia coli ...
-
bioRxiv - Biophysics 2021Quote: ... with the mutation C85A and C-terminal 6×His tag) was obtained as a synthetic gene from Evrogen (Russia) and introduced into the pET11 expression vector (Novagen ...