Labshake search
Citations for Lonza :
351 - 400 of 2319 citations for 2R 5S 5 4 amino 5 fluoro 2 oxopyrimidin 1 2H yl 1 3 oxathiolan 2 yl methyl butyrate WXC04778 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... were purchased from Lonza were cultured in SmGM-2 (Lonza). All cells in the study were routinely tested to confirm no mycoplasma contamination ...
-
bioRxiv - Bioengineering 2020Quote: ... were purchased from Lonza and cultured in EGM-2 (Lonza). Human vascular smooth muscle cells (SMCs ...
-
bioRxiv - Immunology 2020Quote: ... EBM-2 was purchased from Lonza. Human AB serum was purchased from Valley Biomedical ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 mM L-glutamine (Lonza). Cells were washed 3 times with serum-free medium and cultured in RPMI supplemented with 1% EV-depleted FBS for 24 hours ...
-
bioRxiv - Physiology 2022Quote: ... 2 mM L-glutamine (Lonza, UK), 24 μg/mL adenine ...
-
bioRxiv - Physiology 2022Quote: ... 2 mM L-glutamine (Lonza, UK), 100 IU/mL penicillin,100μg/mL streptomycin ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 mM L- glutamine (Lonza)) ...
-
bioRxiv - Cell Biology 2024Quote: ... EBM-2 media (Lonza, CC-3156) supplemented with EGM-2 SingleQuots (Lonza ...
-
bioRxiv - Bioengineering 2024Quote: ... Media (EGM-2; Lonza, Basel, Switzerland) in the reservoirs was changed every other day during the subsequent culture period ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM L-Glutamine (Lonza, BE17605E), 1 mM Sodium Pyruvate (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... supplemented with EGM-2 SingleQuots (Lonza) and Antibiotic-Antimycotic (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: ... were purchased from Lonza and cultured in EGM-2 (Lonza) under 5% CO2 at 37 °C ...
-
bioRxiv - Bioengineering 2024Quote: ... media with EGM-2 BulletKit (Lonza), 2% FBS and 1% penicillin/streptomycin (Gibco).
-
bioRxiv - Bioengineering 2024Quote: ... media with EGM-2 BulletKit (Lonza), 2% FBS and 1% penicillin/streptomycin (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... 2 mM glutamine (Lonza, BEBP17-605E), 50 U/mL penicillin ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM glutamine (all from Lonza) and 800 µg/mL of gentamicin G418 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... nonessential amino acids (Lonza), penicillin (100 IU/ml) ...
-
bioRxiv - Cancer Biology 2022Quote: A small fragment (2-4 mm3) of tumor biopsies or surgically resected tumor was cultured in RPMI 1640 plus (Lonza) containing 10% FBS Hyclone (GE Healthcare) ...
-
bioRxiv - Microbiology 2022Quote: ... for 24 h then interleukin-2 (50U/ml) for 4-6 days before nucleofection (as recommended by the manufacturer, Lonza) or infection by HIV-1.
-
bioRxiv - Neuroscience 2021Quote: ... the suspension was centrifuged (215g for 5min at 4°C) and the pellet was resuspended in BMEC-media that comprised of EBM-2 medium (Lonza) supplemented with the following ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were dissociated into single cells with accutase and 1 million cells were used for nucleofection with 5 μg of gRNA/Cas9 plasmid and 5 μg of each donor plasmid (WT and G12D) using Nucleofector II (Lonza) and program B-16 ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using Sephadex G-25 media (GE Healthcare ...
-
bioRxiv - Biochemistry 2020Quote: ... Fractions were pooled and buffer-exchanged to phosphate-buffered saline (PBS; 140 mM NaCl, 5 mM NaH2PO4, 5 mM Na2HPO4, pH 7.4; Lonza, UK) using a Sephadex G-25 column (GE Healthcare ...
-
bioRxiv - Neuroscience 2024Quote: ... 2.5 × 10 5 phNPCs cells were used per electroporation reaction in one cuvette of the 16-well Nucleocuvette Stripe (Lonza). After trypsinization ...
-
bioRxiv - Cell Biology 2022Quote: ... the mammary glands were digested overnight at 37 ºC and 5% CO2 in a loosely capped 50 ml falcon with 5 ml of DMEM/F12 (Lonza) supplemented with 25 mM HEPES ...
-
bioRxiv - Bioengineering 2022Quote: ... Endothelial Cell Growth Basal Medium-2 (EBM) and EGM-2 SingleQuots™ Supplements were obtained from Lonza. Fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2022Quote: ... and 2*105 HUVECs in a volume of 200 μl EGM-2 medium (Lonza Group Ltd, Switzerland) were seeded and cultivated overnight under static conditions ...
-
bioRxiv - Bioengineering 2022Quote: ... termed assay medium (EBM-2 medium containing hFGF, hydrocortisone, GA-1000, 2% FBS, all from Lonza Biosciences). Cells were allowed to settle for 2 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... The hCMEC/D3 cells were cultured in EBM-2 medium supplemented with EGM-2 MV SingleQuots (Lonza) on plates coated with rat tail collagen I (20 µg/cm2 ...
-
bioRxiv - Bioengineering 2021Quote: ... in EGM-2 MV Microvascular Endothelial Cell Growth Medium containing EBM-2 basal medium (Lonza cat. CC3156) and supplemented with penicillin (50 units/mL ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and EGM™ −2 MV Microvascular Endothelial Cell Growth Medium-2 Bullet KitTM (Cat #CC-3202; Lonza) in collagen coated culture dishes (Cat # 08-772-75 ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... MilliporeSigma) plates with a density of 20,000 cells/cm2 with Endothelial Growth Medium-2 (EGM-2; Lonza), which consists of Endothelial Growth Basal Medium-2 (EBM-2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were cultured in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (Lonza, CC-3162) and plated in T75 culture flask at 5000 cells/ cm2 with iMatrix-511 (Nacalai USA #892021).
-
bioRxiv - Cell Biology 2024Quote: ... were cultured on fibronectin-coated plates in EBM-2 Basal Medium with EGM-2 MV supplements (Lonza) and 10 ug/mL VEGF-C (RnD Systems) ...
-
bioRxiv - Immunology 2022Quote: ... 24 and 48 well-plates in EGM™-2 Endothelial Cell Growth Medium-2 BulletKit™ (LONZA) supplemented with GlutaMax (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Developmental Biology 2020Quote: ... completed with 5% fetal bovine serum (FBS, Lonza) and 2mM L-glutamine (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... and cells were isolated by centrifugation at 500 g for 5 min at 4°C followed by being treated with ACK Lysing Buffer (10-548E, Lonza Bioscience, Switzerland) to remove red blood cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were electroporated at 5 million cells/100 mL cells per cuvette using a Lonza 4-D nucleofector with pulsecode DP-148 (Lonza, VVPA-1002). Cells were co-cultured for 5 additional days with human astrocyte before transferring cells to homeostatic culture conditions (MGdM media ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting mixture was electrophoresed in NuSieve 3:1 agarose (Lonza 50091), and fragments sized 150-350 bp were excised and then purified using a MinElute Gel Extraction kit (QIAGEN 28604) ...
-
bioRxiv - Microbiology 2020Quote: ... Homogenate was resuspended with 6 ml per brain of prewarmed complete media (DMEM [Corning]; 10% FBS; 1% Nonessential Amino Acids Mixture 100x, [Biowhittaker Reagents Lonza],1% GlutaMAX supplement 100x [Thermo Fisher Scientific] ...
-
bioRxiv - Synthetic Biology 2024Quote: ... were mixed at a 5:1 molar ratio and nucleofected using the CB-150 program and P3 primary reagents (Lonza, Cat. No. V4XP-3032) on a Lonza 4D nucleofector following manufacturer protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... for 1.5 h at 37°C and 5% CO2 before seeded with human umbilical vein endothelial cells (HUVECs, pooled donor, Lonza, Switzerland). Endothelial Cell Growth Medium-2 (EGM-2 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were regularly passaged 2-3 times a week and routinely tested for mycoplasma contamination using MycoAlert Plus mycoplasma Detection kit (Lonza, #LT07-710).
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were electroporated with enhancer (IDT, #1075915, final concentration 4 μM) in a nucleofector device (Lonza, Nucleofector 2; program D-032). Cells were incubated for 24 h to allow them to recover and then detached and cloned by serial dilution ...
-
bioRxiv - Immunology 2022Quote: ... 2×106 B cells were then nucleofected with 2 μg of plasmid DNA using Nucleofector Kit V (Lonza) and rested for at least 16-24 hours using complete media containing 5 ng/ml BAFF and lacking LPS ...