Labshake search
Citations for Lonza :
51 - 100 of 652 citations for 3' Bromo 3 3 4 5 trifluorophenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: The 3 kbp DNA plasmid encoding green fluorescent protein (GFP) (Lonza) was used to assess transfection efficiency ...
-
bioRxiv - Neuroscience 2024Quote: ... Retinal tissues were embedded in 3% low-melting agarose (#50100, Lonza) within a plastic cubic mould ...
-
bioRxiv - Developmental Biology 2023Quote: iPSCs were transfected with sgRNA 3’ UCCCUUUCCUCAGGUCACAG 5’ (Synthego) via nucleofection using program CA137 on a 4D Nucleofactor X (Lonza) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Human primary hepatic stellate cells from donors 3 and 4 were purchased as isolated hepatic stellate cells from Lonza (cat# HUCLS). Donor information is listed below.
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting mixture was electrophoresed in NuSieve 3:1 agarose (Lonza 50091), and fragments sized 150-350 bp were excised and then purified using a MinElute Gel Extraction kit (QIAGEN 28604) ...
-
bioRxiv - Neuroscience 2021Quote: ... The behavioral assay consisted of a 3% agarose (SeaKem LE Agarose, Lonza) surface coating (50 mL ...
-
bioRxiv - Molecular Biology 2021Quote: ... as previously described (3) and the Cell Line Nucleofector Kit R (Lonza). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: ... pelleted an incubated for 3’ with ACK lysis buffer(10-548E, Lonza) to remove red blood cells ...
-
bioRxiv - Immunology 2022Quote: ... After 3 days cells were harvested and resuspended in P3 buffer (Lonza), mixed with RNP complexes ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the resulting PCR products were analyzed on a 3 % MetaPhorTM (Lonza) agarose gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3×106 viable cells were resuspended in P3 Primary Cell solution (Lonza), mixed with 2 µM control or 2 µM target-specific ASO and transferred to nucleocuvettes for nucleofection on a 4D-Nucleofector System (Lonza ...
-
bioRxiv - Immunology 2021Quote: ... Human Umbilical Venous Endothelial Cells (HUVEC; pooled from 3 individual donors; LONZA) were starved for 6 h ...
-
bioRxiv - Biophysics 2023Quote: ... After rinsing 3 times with phosphate buffered saline (PBS, 17-517Q, Lonza), cells were stained with Hoechst 33342 in imaging medium for 15 min at 37 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were separated by gel electrophoresis using a 3% MetaPhor agarose (Lonza) using standard techniques ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was loaded onto a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA samples were loaded on 3% NusieveTM GTGTM Agarose gel (Lonza, 50081), and electrophoresis was run at 100V in 1X TBE buffer for ∼50 min ...
-
bioRxiv - Immunology 2020Quote: ... Transfection of primary T cells with Cas9 RNP complexes and TCRβα HDR templates was performed 3-4 days following activation using the 4D-Nucleofector and a 20 uL format P3 Primary Cell kit (Lonza, V4XP-3032). Briefly ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 µg of PX459 gRNA vector (5’-GACTCCAGTCTTTCTAGAAGA-3’) were nucleofected with the AMAXA Mouse Embryonic Stem Cell Nucleofector Kit (LONZA, VPH-100) using program A-30 in the XRep ...
-
bioRxiv - Molecular Biology 2021Quote: ... Purified DNA was separated on a 3% NuSieve GTG agarose gel (Lonza #50081). The gel band corresponding to the size of dinucleosomal DNA (∼250 to 350 bp ...
-
bioRxiv - Genomics 2020Quote: ... Purified DNA was separated on a 3% NuSieve GTG agarose gel (Lonza #50081). The gel band corresponding to the size of dinucleosomal DNA (∼250 to 350bp ...
-
bioRxiv - Bioengineering 2021Quote: ... Erythrocytes were lysed for 3 min on ice in ACK lysing buffer (Lonza), stained with biotinylated lineage antibodies against CD3ε (145-2C11) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Undigested and digested products were resolved in a 3% Metaphor 1:1 (Lonza)/agarose gel (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were separated by 3% low melting agarose gel (Lonza, cat#50111) and detected with Gel Image System (Tanon 1600) ...
-
bioRxiv - Pathology 2024Quote: ... The cells were initially cultured for 3-days in ALI-growth medium (Lonza) based on manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: Neonatal human epidermal keratinocytes (NHEK-Neo) pooled from 3 donors (Lonza, Cat. 00192906) were cultured in KBM Gold keratinocyte basal medium (Lonza ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Alt-R™ HDR donor oligo 5’ GTGTTTAGAAAAAAAAGAGTGTTTTTTTACCAGGGCCTTTGGCTCTTCCAGGAAGCAGATGTCCGAGTCGGAATATAATAACCCTTTCATACTCTTG 3’ (PS modification, antisense; IDT) using a 4D-nucleofector System X Unit (Lonza, Basel, Switzerland) and the P3 primary Cell 4D-Nucleofector® X kit (#V4XP-3024 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1×106 T cells were transfected with Cas9/RNPs complexes of CD38 targeting guide RNA 5’-AGUGUAUGGGAUGCUUUCAA -3’ (Synthego) using Lonza 4D-Nucleofector™ X Unit (Lonza, AAF-1003X). Transfection was carried out in P3 Primary Cell 4D-Nucleofector™ Solution (Lonza ...
-
bioRxiv - Genomics 2020Quote: ... Human umbilical vein endothelial cells were isolated from umbilical cords of healthy donors after cesarean sections (HUVECS; n = 4; RWTH Aachen) (55) or obtained from Lonza (n = 3, Basel, Switzerland) (8) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Bioengineering 2022Quote: ... Calu-3 cells were maintained in EMEM (with EBSS and L-glutamine, BioWhittaker, Lonza) supplemented with 20% FBS (heat-inactivated ...
-
bioRxiv - Bioengineering 2022Quote: ... Human umbilical vein endothelial cells (HUVECS; C2519A) were cultured in EGM-3 medium (Lonza) and were used passages 2-3 for organoids fabrication ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Microbiology 2023Quote: ... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
bioRxiv - Immunology 2023Quote: ... The remaining erythrocytes were lysed with 3 mL ACK lysing buffer (Lonza, Basel, Switzerland) for 5 min at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dinucleosomes were purified and excised from a 3% NuSieve GTG agarose gel (Lonza #50081) using Zymoclean Gel DNA Recovery Kit (Zymo #D4008) ...
-
bioRxiv - Developmental Biology 2022Quote: A single cut in the NKX2.2 3’UTR was made using transient transfection (Lonza Human Stem Cell Nucleofector Kit VPH-5012 ...
-
bioRxiv - Bioengineering 2024Quote: Primary human hepatocytes from 3 different non-diseased donors were obtained commercially (Lonza, #HUCPI). These were quality-controlled ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells in passage 1 were trypsinized and resuspended (3 × 104 cells/mL) in BEGM** (Lonza, see Table S4 for details of media composition ...
-
bioRxiv - Neuroscience 2020Quote: DRG cultures were transfected with 2-3 μg of plasmid using Amaxa Nucleofection device (Lonza) with Basic Neuron SCN Nucleofector kit (Program SCN-8 ...
-
bioRxiv - Microbiology 2021Quote: ... All amplified PCR products were electrophoretically analyzed in 3% agarose gel (MetaPhor Agarose, Lonza Group) stained with 0.5 μg/mL ethidium bromide ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 3 mL TheraPEAK™ ACK Lysing Buffer (1X) (Lonza, Basel, Switzerland). After a 2 minute incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 × 107 cells per plug were embedded in 0.4% SeaPlaque low-melting-point agarose (Lonza) and in the presence of 75 mM EDTA ...
-
bioRxiv - Bioengineering 2023Quote: ... T cells were cultured for 3 days in X-VIVOTM 15 medium (BE02-060F; Lonza) supplemented with 5 ng/mL of IL-15 (130-093-955 ...
-
bioRxiv - Cancer Biology 2023Quote: ... (v) human neonatal dermal fibroblast cell lines NDF-2 and NDF-3 (#CC-2509; Lonza Bioscience ...
-
bioRxiv - Genetics 2021Quote: ... The short pvT1 amplicons were size-separated by electrophoresis in a 3% NuSieve (Lonza, Basel, Switzerland) agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cell suspensions were mixed with ultra low melting agarose solution (3% SeaPrep®, LONZA, #50302) in a volume ratio of 1:1 and were loaded onto the two aqueous phase inlets of the FFD ...
-
bioRxiv - Immunology 2022Quote: ... The isolated splenocytes were incubated for 3 mins in red blood cell lysis with ACK (Lonza) followed by washing with media ...
-
bioRxiv - Biophysics 2020Quote: ... ∼300 pairs of ovaries were harvested from 3-6 day old females in 1X PBS (Lonza) with 1 mM DTT (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... Antibodies which contained endotoxin levels above 3 EU/ml (Kinetic-QCL Kinetic Chromogenic LAL Assay, Lonza) were depleted of endotoxin with the ToxinEraser Endotoxin Removal kit (GenScript ...