Labshake search
Citations for PerkinElmer :
301 - 350 of 1046 citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Fluorescence was measured (excitation, 530 nm; emission, 595 nm) by a Victor 3 V 1420 microplate reader (Perkin Elmer).
-
bioRxiv - Cell Biology 2020Quote: ... Fluorescence (λex = 525 nm; λem = 590 nm) was measured 3 h later in an Enspire Plate Reader (Perkin Elmer). For Nalm6 ...
-
bioRxiv - Physiology 2021Quote: ... where whole-body glucose flux was traced by infusion of 0.05 μCi/min D-[3-3H]-glucose (Perkin Elmer), after a priming 5 μCi bolus for 1 minute ...
-
bioRxiv - Physiology 2020Quote: ... The fluorescence signal was developed with tyramide signal amplification (TSA) Plus Cyanine 3 System kit (PerkinElmer, Waltham, Massachusetts, USA) as described previously (Tulke et al. ...
-
bioRxiv - Immunology 2021Quote: ... plasma solution at a rate of 0.18 ml/h for 90 min in parallel with a primed-continuous tracer D-[3-3H]-Glucose infusion (PerkinElmer, Waltham ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... [14C]-tetraethylammonium specific activity= 3.5 mCi/mmol) and [3H]-estrone 3-sulfate specific activity= 49.19 Ci/mmol) were purchased from Perkin Elmer. [3H]-phenylalanine (specific activity= 100 Ci/mmol) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were then rinsed in TBST 3 times and treated with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA). Membranes were exposed to GE Healthcare Hyperfilm ECL (28906839 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Dehydrated coverslips were overlaid with 0.3 μg/ml TAMRA–OO-(CCCTAA)3 or 0.3 μg/mL Alexa 488–OO-(CCCTAA)3 telomeric PNA probe (Panagene) in PNA hybridization solution (70% deionized formamide, 0.25% (v/v) NEN blocking reagent (PerkinElmer), 10 mM Tris–HCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... ORO was measured by extracting lipids with a petrol ether/isopropanol mixture (3:2) and quantified for their absorbance at 490 nm for 0.1 s with Victor Spectrophotometer (PerkinElmer). Standard curve was applied and quantification was expressed in µg of pure ORO powder.
-
bioRxiv - Microbiology 2024Quote: ... Zn2+ and Mn2+ amounts were calculated from standard curves made with Pure Plus Multi-Element Calibration Standard 3 (0.5-100ppb, PerkinElmer). Metals amounts detected in the 30% HNO3 blank were subtracted from all samples ...
-
bioRxiv - Molecular Biology 2024Quote: Mice were deprived of food for 3 h before intravenous injection of L-[4,5-3H(N)]leucine (NET1166, PerkinElmer) at a dose of 1 μCi/g ...
-
bioRxiv - Plant Biology 2024Quote: ... and the reactions were initiated by the addition of 3 μL of 52.6 mCi/mmol S-[methyl-14C]adenosyl-L-methionine (PerkinElmer). The reaction was overlaid with 1 mL of pentane and incubated 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... whole blood activity and plasma activity after centrifugation were measured in a gamma-counter (Wizard2, 3”; Perkin Elmer, USA). The whole blood curve was linearly interpolated and resampled to match the time points of the reconstructed fPET frames ...
-
bioRxiv - Microbiology 2024Quote: Huh-7 and Calu-3 cells were seeded in 96-well plate 96-CellCarrierUltra plates (Perkin Elmer, Hamburg, Germany), treated with ARN726 30 μM or GW6471 1μM and infected with SARS-CoV-2 1 MOI and 0.1 MOI respectively ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 1 µCi of [1-14C]-palmitate (2.22 GBq mmol-1, Perkin Elmer) was added to 10 ml culture medium of exponentially or stationary phase-grown bacteria and further incubated for 1.5 h at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 300 μl of each supernatant were mixed with 4 ml of Ultima Gold liquid scintillation cocktail (PerkinElmer) and run on a Hidex SL300 counter ...
-
bioRxiv - Plant Biology 2023Quote: ... The same seeds were transferred into weighing cup and weighed with an AD-4 Autobalance (PerkinElmer, Inc.). Single seed weight was subsequently determined by dividing the total weight by the number of seeds.
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed in TBST at least 3 times and probed with Western Lightning Plus ECL reagent (PerkinElmer, NEL105001EA) and exposed to GE Healthcare Hyperfilm ECL (28906839).
-
bioRxiv - Cancer Biology 2021Quote: Bioluminescence signals in exosomes and MVs (3 × 107 EVs/µL) carrying PalmReNL were measured at room temperature (25°C) using a VICTOR Nivo Microplate Reader (PerkinElmer). EVs were incubated in the presence or absence of 1% Triton X-100 for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection was performed using the either the TSA Cyanine 3 Plus or the TSA Plus Fluorescein Evaluation Kits (Perkin Elmer).
-
bioRxiv - Molecular Biology 2021Quote: ... from which aliquots of 10 μL were counted in vials with 3 mL OptiPhase HiSafe3 scintillation fluid (PerkinElmer, #1200-437). The fraction of charged tRNAAsn was calculated based on the charged tritium labeled aspartate incorporated into the pellet ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Live and dead cell counts were measured daily over a 3-day period using the Operetta High Content Screening system (PerkinElmer). Prior to imaging ...
-
bioRxiv - Genomics 2021Quote: ... and transferred to a plastic scintillation vial containing 10 mL of OptPhase HiSafe 3 scintillation cocktail (PerkinElmer, Waltman, MA, USA). All vials were counted for 10min using a Tri-Carb 2810 TR liquid scintillation analyzer (PerkinElmer ...
-
bioRxiv - Genomics 2021Quote: ... Aliquots of 10E6 nuclei were subjected to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) and PRO-seq libraries were constructed in duplicate as described (31) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mice were anesthetized with 3% isoflurane before retro-orbital injection with d-luciferin (150mg/Kg) (Perkin Elmer S.L., Cat. 122796) and imaged with an IVIS Xenogen machine (Caliper Life Sciences) ...
-
bioRxiv - Immunology 2023Quote: ... The slides were subjected to sequential staining cycles as described before,3 although now automated using Opal 7-color Automation IHC Kit (NEL801001KT; PerkinElmer) on the BOND RX IHC & ISH Research Platform (Leica Biosystems ...
-
bioRxiv - Genomics 2022Quote: ... PRO-seq libraries for all replicates were then prepared simultaneously by subjecting one aliquot of 1e7 nuclei/sample to 3-minute nuclear run-on reactions in the presence of Biotin-11-CTP (PerkinElmer) following our previously detailed protocol (24) ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The distal 3 cm of the colon was removed and imaged using an IVIS fluorescence imager (IVIS 200, Perkin Elmer). Fluorescent signal intensity was quantified using Living Image 4.3.2 software (IVIS 200 ...
-
bioRxiv - Synthetic Biology 2023Quote: The spectra of three samples (n=3) of both fresh and decellularized banana leaves were collected using a Fourier-transform infrared spectrometer (FTIR) (PerkinElmer Universal ATR ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse primer contained an Illumina 3’ adapter sequence and an index sequence to uniquely identify each library (NextFlex DNA barcodes, PerkinElmer). Libraries were purified and quantified using the dsDNA Fluorescence Quantification Assays (DeNovix ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed 3 days after injection of tumour cells and once weekly thereafter using an IVIS Spectrum in vivo Imaging System (PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). D-luciferin (potassium salt ...
-
bioRxiv - Cancer Biology 2022Quote: ... Whole-body imaging to monitor luciferase-expressing LNCaP cells was performed at day 3 of the injection and once weekly after that using the In Vivo Imaging System (IVIS, PerkinElmer). Following 1-week post-injection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Biochemistry 2023Quote: ... The hydrolysis reaction was then measured by absorbance at 630nm (read time of 0.1s per well, Victor 3 from Perkin Elmer) after incubating with malachite green reagent for a minimum of 8min under agitation.
-
bioRxiv - Genomics 2022Quote: ... nuclei were extracted from ~2×107 cells and run-on reactions were carried on at 37°C for 3 minutes using 3μl of each 11-biotin-labelled ribonucleotide stocks (Perkin Elmer). Following real time PCR amplification in the presence of EvaGreen dye as above ...
-
bioRxiv - Cell Biology 2024Quote: The glucose uptake was determined by seeding hBMSCs (passage 3) in a 96-well black/clear bottom plate (Perkin Elmer) at a density of 6,000 cells/well (6 wells/group) ...
-
bioRxiv - Cell Biology 2020Quote: ... and all qualitative imaging of Kif19 plasmids were conducted on a 4-D spinning-disk confocal microscope (PerkinElmer) with 60x (1.4 NA ...
-
bioRxiv - Neuroscience 2020Quote: ... TR-FRET measurements were routinely performed following overnight incubation at 4°C using an EnVision Reader (Perkin Elmer). Values were collected as the background subtracted ratio between fluorescence emission at 665 nm and 615 nm where the background signal corresponds to the ratio (665/615 ...
-
bioRxiv - Microbiology 2021Quote: KN99α was grown as described above in MM supplemented with 2 μCi/ml 3H-NE and 1.0 mM unlabeled NE or a mixture of 1.0 mM unlabeled NE and DA or with 4 μCi/mL (0.0001 mM) Dihydroxyphenylethylamine 3,4-[Ring-2,5,6-3H] (3H-DA, Perkin Elmer NET673250UC) and 1.0 mM unlabeled DA or 1.0 mM unlabeled NE and DA for 10 d at 30°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... or 4 µl of suspension was carefully distributed in the centre of an optical-bottom 96-well (PerkinElmer) for immunofluorescence experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... Live imaging was done 4-8h later using a spinning disk confocal microscope (Perkin Elmer Ultra View ERS) equipped with a heating chamber (37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... filters were placed into scintillation vials with 4 mL Emulsifier-safe liquid scintillation fluid (Perkin Elmer, Waltham, MA) and analyzed using a liquid scintillation counter ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were fixed in 4% PFA and imaged with the Opera Phenix High Content Screening System (Perkin Elmer), acquiring at least 10 images per well ...
-
bioRxiv - Cell Biology 2023Quote: ... the rabbit reticulocyte lysate master mix was supplemented with EasyTag L-35-Methionine (4% final reaction volume; PerkinElmer). Canine rough pancreatic microsomes (cRMs ...
-
bioRxiv - Immunology 2022Quote: ... Prior to the immunization all mice were anesthetized by isoflurane inhalation with RAS-4 Rodent Anesthesia System (PerkinElmer). Mice were euthanized on day 28 for terminal blood collection and spleens were harvested for cellular assays ...
-
bioRxiv - Plant Biology 2022Quote: ... dissolved in 0.1% nitric acid and 4 mL Optima Gold XR scintillant (Perkin Elmer, Glen Waverley, VIC, Australia) was added prior to counting for two minutes using a Liquid Scintillation Counter (LS6500 ...
-
bioRxiv - Cancer Biology 2020Quote: ... the extent of lung metastasis was measured every 3 days for 12 days using non-invasive imaging with IVIS Lumina III (Perkin Elmer). In brief ...