Labshake search
Citations for Qiagen :
1 - 29 of 29 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA was eluted in 45 µl of EB buffer (10 mM tris-hydrochloride, pH 8.0; QIAGEN, Netherlands) supplemented with 0.05% (v/v ...
-
bioRxiv - Physiology 2024Quote: RNA was collected from the cells without H/R and after H/R stress with the RNEasy kit (Qiagen) the RNA quality and quantity was evaluated using a μLITE analyzer (BioDrop ...
-
bioRxiv - Microbiology 2020Quote: ... We eluted purified DNA in 45 µl of EB buffer (10 mM tris-hydrochloride (pH 8.0) (Qiagen, The Netherlands) supplemented with 0.05% (v/v ...
-
bioRxiv - Genetics 2023Quote: ... Precipitated proteins were resuspended in 6M guanidine hydrochloride and incubated with 25 µL of Ni-NTA agarose beads (Qiagen) overnight ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in buffer A supplemented with 8 M guanidine hydrochloride (= buffer B) and loaded onto an Ni-NTA agarose column (QIAGEN) pre-equilibrated in the same buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene of interest (GOI) siRNA or control siRNA were incubated at room temperature with Enhancer R and Buffer EC-R (Qiagen, USA) for 20 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
bioRxiv - Genetics 2020Quote: ... we split the 50 μl reaction volume into two and we added 25 μl of guanidine hydrochloride (Buffer PB, Qiagen 28606) to each as a chaotropic agent to stop the reaction and dissociate the proteins and transposase from the DNA ...
-
bioRxiv - Neuroscience 2024Quote: ... Inclusion bodies were solubilized in 8 M guanidine hydrochloride (GdnHCl) and then PrP was captured using Ni-NTA Superflow beads (Qiagen #30410). Bead-bound PrP was refolded on-column using a 4 h gradient from 6 to 0 M GdnHCl and then eluted using a gradient from 0 to 500 mM imidazole ...
-
bioRxiv - Plant Biology 2021Quote: DNA was extracted using either the DNeasy(R) kit (Qiagen) or the method described by Poudel et al ...
-
bioRxiv - Cell Biology 2023Quote: ... MI and MI/R using RNeasy RNA isolation Kit (Qiagen) coupled with an on-column DNase I digestion to eliminate residual DNA ...
-
bioRxiv - Immunology 2020Quote: ... Pathway enrichment utilized R packages gage and fgsea or Ingenuity Pathway Analysis (Qiagen). Gene-set enrichment analysis (GSEA ...
-
bioRxiv - Cell Biology 2024Quote: ... Total R NA was extracted using the RNeasy Plus Mini Kit (Qiagen, 74134) according to manufacturer protocol ...
-
bioRxiv - Microbiology 2021Quote: ... K-means clustering was performed in R and functional analysis was performed using IPA [18] (QIAGEN Inc. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Data analyses were performed using R (Version 1.0.44, RStudio Inc.) and Ingenuity Pathway Analysis (QIAGEN Bioinformatics). The comparison between each group (Post 3 vs pre ...
-
bioRxiv - Cancer Biology 2022Quote: mARN from GLO and GLO-R were extracted in duplicates with the RNeasy mini kit (Qiagen) with DNase treatment ...
-
bioRxiv - Microbiology 2020Quote: ... A qRT-PCR from RIDAgene (r-biopharm, Darmstadt, Germany) followed on Rotor-Gene Q (Qiagen, Hilden, Germany) to detect the E-gene of SARS-CoV-2 ...
-
bioRxiv - Cell Biology 2022Quote: ... All the downstream analyses were performed using R toolkit Seurat24 and Ingenuity pathway analysis (IPA) software (Qiagen).
-
bioRxiv - Immunology 2020Quote: ... A qRT-PCR from RIDAgene (r-biopharm, Darmstadt, Germany) followed on Rotor-Gene Q (Qiagen, Hilden, Germany) in order to detect the E-gene of SARS-CoV-2 ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from collected midguts with RNeasy R Plus Mini Kits (Qiagen, Valencia, CA, USA). After genomic DNA was digested by RNase-free DNase (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: Microbiome data analyses were performed in R Bioconductor ecosystem (R version 4.2.3) and with a CLC Microbial Genomics Module (CLC Genomics Workbench 21.0.3, Qiagen, USA), which complies with QIIME2 (18) ...
-
bioRxiv - Genomics 2022Quote: ... or mock digestion (protocol without RNase R) followed by clean-up with the Qiagen RNeasy Mini kit (Q74106, Qiagen). RNA-seq libraries were prepared with the TruSeq Stranded Illumina Total RNA Preparation Kit (20020599 ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from collected BmCPV-infected midguts with RNeasy R Plus Mini Kits (Qiagen, Valencia, CA, USA). After genomic DNA was digested by RNase-free DNase (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic high-molecular-weight DNA was extracted from cell pellets using MagAttract R HMW DNA Kit (Qiagen, Hilden, Germany) to a final elution volume of 100 μL ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Genomics 2023Quote: ... 1µM Template-Switching Oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” prefixes a ribonucleic acid base and “+” prefixes a locked nucleic acid base, Qiagen) then incubated using a ThermoMixer C with the following conditions ...
-
bioRxiv - Genetics 2024Quote: ... The first PCR amplified from HTT to GFP (F: ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC, R: GTCCAGCTCGACCAGGATG) Taq PCR Core Kit with Q solution (Qiagen) with 5 µL of the genomic DNA with initial denaturation 95°C (5 min) ...
-
bioRxiv - Microbiology 2024Quote: ... ACCTGGTTGATCCTGCCAGGTAGC and R: AGC CAT TCG CAG TTT TGT AC prior to purification using a QIAquick gel extraction kit (Qiagen). ISG15 gene expression was quantified using a SYBR Green-based real-time RT-PCR kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each individual run included rickettsial genomic DNA (R. rickettsii Sheila Smith prepared as previously reported using DNeasy Blood and Tissue Kit (Qiagen, 69504) or relevant plasmid at 1 ng/μL as a positive control for each primer set ...