Labshake search
Citations for Qiagen :
1 - 49 of 49 citations for FITC labeled Fibrinogen since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... FITC-conjugated HSATII probes were purchased from QIAGEN and are based on the sequence used in previous publications (Hall et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... FITC-conjugated HSATII probes were purchased from QIAGEN and are based on the sequence used in previous publications (Hall et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Plant Biology 2021Quote: ... labeled proteins were incubated with Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... The nick-labeled sample was treated with proteinase K (QIAGEN) at 50°C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... CjNC110-LNA DIG-labeled probe (/5’DigN/ GCACATCAGTTTCAT/3’Dig_N/) (QIAGEN) was added to 15 mL DIG EasyHyb™ Buffer (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antisense LNA GapmeRs (custom designed, 3’-FAM-labeled, Qiagen, Table S5) were bilaterally microinfused using a 2 μl calibrated micropipette (Hamilton syringes ga 25/70mm/pst3) ...
-
bioRxiv - Neuroscience 2024Quote: ... labeled CPN or CThPN somata were sorted into RLT buffer (Qiagen) supplemented with 10% b-Mercaptoethanol using a customized SORP FACSAriaII (BD Instruments ...
-
bioRxiv - Microbiology 2021Quote: ... The labeled cDNAs were purified with a QIAquick PCR purification kit (Qiagen). DNA microarrays were processed and analyzed as previously described [59] ...
-
bioRxiv - Genomics 2020Quote: ... Labeled PCR product was purified with a QIAquick PCR Purification Kit (QIAGEN) and 50ng was mixed with hybridization buffer ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... Labeled DNA was purified using a spin column PCR purification kit (Qiagen) and eluted with 10 mM Tris-HCl ...
-
bioRxiv - Systems Biology 2021Quote: ... Purified labeled RNA (LRNA) and FRNA were subjected to DNase digestion (Qiagen, 79254). Total fragmented RNA and labeled RNA libraries were prepared with Ovation Universal RNA-Seq kit (NuGEN ...
-
bioRxiv - Genetics 2023Quote: ... The labeled DNA was purified using the Qiaquick PCR purification kit from Qiagen, eluted in 30 μl of water ...
-
bioRxiv - Cancer Biology 2023Quote: ... The purification of the labeled cDNA was performed with RNeasy Mini kit (Qiagen) according to Agilent’s One-Color Gene Expression Microarray Protocol followed by the quantification using a NanoDrop2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... The labeled DNA was purified using the Qiaquick PCR purification kit from Qiagen, eluted in 30 µl of water ...
-
bioRxiv - Microbiology 2022Quote: ... FITC-negative and non-sorted fractions immediately after cell sorting using the QIAmp DNA Microbiome kit (Qiagen) and a FastPrep-24 Classic homogenizer (MP Biomedicals ...
-
bioRxiv - Biophysics 2023Quote: Fluorescently labeled 207 bp DNA fragments were purified with a PCR purification kit (Qiagen), and nucleosome reconstitution performed as described above ...
-
bioRxiv - Systems Biology 2023Quote: ... For the total fractions we lysed the metabolically labeled cells directly in Qiazol (Qiagen).
-
bioRxiv - Genetics 2023Quote: ... with biotin-labeled methylation-specific primers designed with Pyromark Assay Design Software 2.0 (Qiagen). The primer sequences are shown in Supplemental Table S1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Digoxigenin labeled miRCURY LNA probes (HSA-MIR-10B-5P, SCRAMBLE-MIR, miRCURY LNA U6, Qiagen) were diluted in hybridiziation buffer after a denaturation step at 90 °C and incubated on cells for 30 min (60 min tissue sections ...
-
bioRxiv - Neuroscience 2021Quote: ... Purification of C-terminal His6-tag-labeled GluN1 and GluN1ΔM4 by Ni2+-NTA agarose (Qiagen) chromatography was performed as in (Madry et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... fluorescently labeled GC particles were collected in RLT (Allprep DNA/RNA Micro Kit #80284, Qiagen) supplemented with 10% b-Mercaptoethanol.
-
bioRxiv - Microbiology 2024Quote: ... These labeled probes were amplified by PCR and purified by using clean-up kit (Qiagen). EMSA was performed as follows ...
-
bioRxiv - Bioengineering 2022Quote: ... Scrambled siRNA and Alexa Fluor 546 labeled siRNA (AF546-siRNA) were purchased from Qiagen (MD, USA). mRNA targeting firefly luciferase was purchased from Trilink Biotechnologies (CA ...
-
bioRxiv - Biochemistry 2021Quote: ... The Cy3-CTP labeled cRNA sample was purified using the Qiagen RNeasy column (Qiagen, Cat # 74106). The concentration of cRNA and dye incorporation was determined using Nanodrop-1000.
-
bioRxiv - Cell Biology 2022Quote: ... Dual labeled miRCURY LNA miRNA detection probes of dre-mir-430a-3p and scramble-miR (Qiagen, catalogue no ...
-
bioRxiv - Cell Biology 2020Quote: ... The eluted 4sU-labeled RNA and reserved total RNA were purified with the miRNeasy Micro kit (Qiagen) according to the manufacturer’s protocol with on-column DNase I treatment ...
-
bioRxiv - Genomics 2021Quote: ... The fragmented and labeled DNA samples were purified from excess nucleotides using “QIAquick PCR Purification Kit” columns (QIAGEN), according to manufacturer’s recommendations.
-
bioRxiv - Neuroscience 2021Quote: ... Hybridization was performed with a double DIG-labeled locked nucleic acid (LNA) probe for Nato3 (/5DiGN/ACTCAGCGTCTATCTCACCGA/3DiG_N/) (Qiagen) and incubated overnight at 62 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-sense DIG-labeled RNA probes were generated by in vitro transcription and purified with the RNeasy kit (Qiagen). At 55-62°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... washed twice in PBS and DNA was labeled with propidium iodide (50 μg/ml) in presence of RNase A (0.2 mg/ml, Qiagen) and Triton X-100 (0.1%) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNA was labeled with propidium iodide (50 μg/ml) in the presence of RNase A (0.2 mg/ml, Qiagen) and Triton X-100 (0.01% ...
-
bioRxiv - Cell Biology 2020Quote: ... and 25 ng of each of the secondary probes (LNA oligonucleotides targeting FLAP X and FLAP Y labeled with TYE 563, Qiagen) were pre-hybridized in either 100μL of 1X SSC for conventional smiFISH ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng DNA was random prime labeled (ENZO) with Cy3 (Sample DNA) or Cy5 (Input DNA) and purified on a MinElute PCR purification column (Qiagen). Labeled DNA was diluted in hybridization buffer (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: ... and 25 ng of each of the secondary probes (TYE 563 labeled LNA oligonucleotides targeting FLAP X and FLAP Y, Qiagen) were pre-hybridized in 100 μL of the following buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... were amplified using biotin-labeled primers (Supplementary Table 2) synthesized by Sangon Biotech (Shanghai, China) and purified by a PCR purification kit (Qiagen). The EMSA was conducted as described previously(An et al. ...
-
bioRxiv - Microbiology 2020Quote: ... and a portion of the tissue (0.08-0.3g) was placed into pre-labeled microcentrifuge tubes containing 5 mm stainless steel beads (Qiagen Inc., CA). Lung samples were homogenized with DMEM + 2% FBS in a TissueLyser (Qiagen Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... SiCBL4 and SiCBL7 promoters were respectively amplified using biotin-labeled primers (Table S1) synthesized by Sangon Biotech (Shanghai China) and purified using a PCR purification kit (Qiagen). EMSA was conducted using a LightShift Chemilumniescent EMSA Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Then this amplified product was labeled with biotin at 5’ end followed by purification using the Qiaquick nucleotide removal kit (QIAGEN).To check the drug-protein interaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... Digoxigenin-labeled LNA probes against mito-tRNA Asn and nuclear-encoded tRNA Asn designed by Qiagen (sequences in supplementary methods) were boiled for 2 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... The primer extension reaction was performed in a volume of 20 μL with a 32P-labeled primer (complementary to galM of the galactose operon mRNA; Table S1) and 1 U of Taq polymerase (Qiagen) (X et al ...
-
bioRxiv - Microbiology 2024Quote: ... was labeled and stored at -80°C until DNA was extracted using the DNeasy PowerMax Soil kit (12988-10, Qiagen).
-
bioRxiv - Developmental Biology 2024Quote: ... The membrane was then hybridized with 50 pmol mL−1 Biotin-labeled Locked Nucleic Acid-modified DNA probes (designed and synthesized by Qiagen) specific to the 5’ end of tRNA-ValCAC and 5S rRNA ...
-
bioRxiv - Genomics 2021Quote: ... We checked ASOs penetration in cells by means of the 5′-FAM-labeled control ASO A provided by Qiagen (Figure S5f).
-
bioRxiv - Biochemistry 2021Quote: ... The labeled protein in the soluble fraction was purified using Immobilized Metal Affinity Chromatography (IMAC) using standard methods (QIagen Ni-NTA resin). The purified protein was then concentrated to 2 mL and purified by FPLC sizeexclusion chromatography using a Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Biophysics 2022Quote: ... End-labeled lambda DNA was purified using Qiaex II gel-extraction DNA clean-up kit following the manufactures’ instructions (Qiagen cat# 20021).