Labshake search
Citations for Qiagen :
401 - 450 of 1267 citations for 2 CHLOROMETHYL 6 METHOXY 1H BENZO D IMIDAZOLE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Key genes involved in the regulation and enzymatic pathways of fatty liver were simultaneously assayed with the RT2 Profiler PCR Array Human Fatty Liver (PAHS-157ZC-6) (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions and analyzed with the Data Analysis Center (QIAGEN Hilden ...
-
bioRxiv - Biochemistry 2022Quote: ... UNC-6 and UNC-40 constructs of various lengths were purified first with Ni-NTA metal-affinity chromatography (QIAGEN, cat. no. 30210) from conditioned media ...
-
bioRxiv - Physiology 2023Quote: Total RNA and miRNA was extracted from liver and distal intestine (n = 6 per condition) using a miRNeasy Tissue/Cells Advanced Mini Kit (Qiagen, Hilden, Germany) following the protocol provided by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... collected into an Eppendorf tube and centrifuged at 11200 rpm at 4 °C for 6 min followed by pellet resuspension with 200 μl of QIAzol (Qiagen, Hilden, Germany). To isolate EC from the bottom layer ...
-
bioRxiv - Physiology 2023Quote: ... proximal intestine and distal intestine (n = 6 per sampling day and diet) according to the miRNeasy Tissue/Cells Advanced Mini Kit protocol (Qiagen, Hilden, Germany). RNA was treated with the Turbo DNA-free kit (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... E17 and P0 (n=6 embryos per sex and time point) using the Qiagen miRNeasy mini kit (CatNo. 217004; Qiagen; Hilden, Germany). 500 ng of total RNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 10 ruddy bowfin and 6 eyetail bowfin (see below) and RNA was extracted from each individual tissue following manufacturer protocols (RNeasy kit; Qiagen, Germantown, MD). RNA was quantified using a NanoDrop 1000 (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... All transfections were performed in D- or C-medium by using HiPerFect Transfection Reagent according to manufacturer’s instructions (301704, Qiagen, Hilden, Germany). After transfection for 24 hours ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was isolated from leaves of 21-d-old plants (as above) using the RNeasy plant mini kit (Qiagen, USA). Isolated RNA was treated with DNase (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... Up to 8 colonies were selected for each TCRα and TCRβ sequence for each of the KRASG12V/D-specific T cell clones and DNA was isolated using a QIAprep Spin Miniprep Kit (QIAGEN, 27104) and sequenced using the M13F and M13R primers ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from MCF10AER/vSrc cells (Control and treated with 10 nM D-Alanine for 4 h or 24 h) using RNeasy Kit (Qiagen, #74104) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was isolated from 10-d-old seedling roots (40 for each line) using the RNeasy Plant Mini Kit (Qiagen, Germany). cDNA was synthesized using TOPscriptTM RT DryMIX (dT18 ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Biochemistry 2024Quote: ... the EcNhaA triple mutant was extracted from membranes with n-Dodecyl β-D-maltoside (DDM; Glycon) and purified by Ni-nitrilotriacetic acid (Ni-NTA; Qiagen) affinity chromatography ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 hours and purified using QIAquick PCR Purification Kit (Qiagen). Guide RNA sequence was ordered as oligos (Tm = 51°C ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2× volume of RNAprotect Bacteria Reagent (QIAGEN) for 10 min at room temperature and collected as pellets by centrifugating for 10 min at 5,000×g ...
-
bioRxiv - Genomics 2024Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Genomics 2024Quote: ... 2 ml of RNAprotect® Bacteria Reagent (cat # 76506, Qiagen Inc.) was added ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... total RNA and genomic DNA was extracted from flash frozen testes of a subsample of males 6 to 10 days following injection with the dsRNA using a Qiagen Allprep DNA/RNA Mini Kit (Qiagen, Venlo, The Netherlands). Expression levels for Dnmt1 was analyzed using qRT-PCR as described above.
-
bioRxiv - Plant Biology 2020Quote: ... and whole seedling shoot of 8-day-old seedling (Figure 2C and Supplemental Figure 6) were used to extract RNA using the RNeasy® Mini kit (Qiagen, Hilden, Germany) followed by DNase I (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... was induced by adding isopropyl β-D-1-thiogalactopyranoside (IPTG) into the LB media and purified by Ni-NTA affinity chromatography (Qiagen, USA). The full length of ASSCP2 protein (ASSCP2-R ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 12-d-old seedlings grown at 22°C in LD conditions at ZT13 with the RNeasy® Plant Mini Kit (QIAGEN, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: Total RNAs were extracted from Wildtype MIN6 and MIN6 stably expressing shRNAs (non-specific/NS, C, D) using RNeasy kit (QIAGEN, Germantown, MD) and cDNAs were prepared using qScript cDNA SuperMix (Quantabio ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Generation of cDNA was performed by GoTaq 2-step RT system (Qiagen). Real-time PCR reactions were measured by ABI StepOnePlus system using SYBR green qPCR master mix (ThermoFisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2-mercaptoethanol and purified using the RNeasy Micro kit (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... 6xHis-tagged CDK-2 was purified using Ni-NTA resins (Qiagen 30210) and eluted in PBS ...
-
bioRxiv - Plant Biology 2021Quote: ... nks1-1 and nks1-2 using RNeasy Plant mini kit (74904, QIAGEN). cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691 ...
-
bioRxiv - Microbiology 2020Quote: ... except that 2 mL prefilled bead tubes (Qiagen; catalog no., 13118-50) were used for the bead beating ...
-
bioRxiv - Microbiology 2022Quote: ... (2) PCR purification was conducted using the QIAquick PCR Purification Kit (Qiagen), and (3 ...