Labshake search
Citations for Qiagen :
301 - 350 of 2481 citations for 3' Methyl 1 1' biphenyl 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... resuspended in 1 mL of inhibitEX buffer (Qiagen), and transferred to 2 mL tubes containing 0.5 g of 0.1 mm zirconium beads (Biospec) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted with 1 volume of 25:24:1 phenol-chloroform-isoamyl alcohol and purified with QIAquick PCR Purification Kit (QIAGEN 28104). Libraries were prepared with the Ovation Ultralow V2 DNA-Seq Library Preparation Kit (NuGEN (Redwood City ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... 120 mg l− 1 sodium pyruvate and 1% penicillin–streptomycin) at 300 Hz for 2 minutes using a TissueLyser II (Qiagen, Germany).
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated for 1 hour with monoclonal α-His antibodies conjugated to the horseradish peroxidase (1:5000 dilution; Qiagen). Blots were visualized with the addition of Lumina Forte Western HRP Substrate (MilliporeSigma ...
-
bioRxiv - Cell Biology 2024Quote: HeLa or HEK293 cells were grown in Dulbecco’s Modified Eagle Medium (DMEM, low glucose 1 g L−1, Qiagen #31885-023) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Immunology 2024Quote: Total RNA from epididymis white adipose tissue of wide type control mice (n=3) and miR-802 KI mice (n=3) was isolated using the RNeasy mini kit (Qiagen) following the protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was obtained and amplified in a first-round PCR (RdRpS1 5’-GGKTGGGAYTAYCCKAARTG-3’, RdRpR1 5’-TGYTGTSWRCARAAYTCRTG-3’) using One-Step RT-PCR Enzyme MixKit (Qiagen) with the total expected size of 602 base pairs (bp) ...
-
bioRxiv - Genomics 2024Quote: ... RNA was first amplified using a first-round PCR (RdRp S1 5ߣ-GGKTGGGAYTAYCCKAARTG -3’, RdRp R1 5’-TGYTGTSWRCARAAYTCRTG-3’) with the One-Step RT-PCR Enzyme MixKit (Qiagen), targeting a total expected size of 620 base pairs (bp) ...
-
bioRxiv - Cell Biology 2024Quote: ... target sequence 5’-TTGCTTGGAGGCTACTCCCAA-3’) and control non-silencing scrambled siRNA (siSCR, target sequence 5’-AATTCTCCGAACGTGTCACGT-3’) were obtained from Qiagen. MAPK15-specific siRNA #2 (siMAPK15 #2 ...
-
bioRxiv - Genetics 2024Quote: ... Total RNA isolation from Tbx4-CKO (n = 3) and Tbx4fl/fl (n = 3) lungs was performed using the RNeasy Mini Kit (Qiagen). The changes in gene expression were investigated by quantitative reverse transcription polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... along with the human NaV β1 and β2 subunits (2 μg total plasmid DNA was transfected with a cDNA ratio of 10:1:1 for NaV1.X:β1:β2 subunits) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.). Human β1 and β2 cDNAs were cloned into plasmids encoding the CD8 receptor (CD8-IRES-hβ1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transiently co-transfected with NaV1.2 and the accessory β1 and β2 subunits (2 μg total plasmid DNA was transfected with a cDNA ratio of 10:1:1 for NaV1.2:β1:β2 subunits) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.). Human β1 and β2 cDNAs were cloned into plasmids encoding the CD8 receptor (CD8-IRES-hβ1 ...
-
bioRxiv - Microbiology 2020Quote: Total RNA extraction was performed using a squash buffer (10 mM Tris base, 1 mM EDTA, 50 mM NaCl) supplemented with 1:8 part Proteinase K (Qiagen, 15mg/ml). Mosquito abdomens with the midguts and heads with thoraces were individually collected in 50 μl of squash buffer at 7 and 14 days ...
-
bioRxiv - Microbiology 2022Quote: ... Total DNA (including integrated HIV-1 DNA and episomal HIV-1 DNA) was extracted using the QIAmp blood DNA minikit (Qiagen, Courtaboeuf, France) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Evolutionary Biology 2020Quote: ... washed with 1 ml RNAprotect® Cell Reagent (Qiagen) and centrifuged for 10 min at 2,500 x g ...
-
bioRxiv - Genomics 2020Quote: ... 5 µL Proteinase-K (20 mg ml-1, Qiagen) was added to the solution and incubated at 60°C for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 µl zymolyase and 1 mg/ul RNase (QIAGEN). This was incubated in a 37 °C shaker for 1 hour before the addition of Proteinase K (10 µl ...
-
bioRxiv - Physiology 2021Quote: 1 μg purified extracted RNA (RNeasy Mini Kit, Qiagen) was reverse transcribed using qScript Reverse Transcriptase (Quanta Biosciences ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of proteinase K (20 mg/mL, Qiagen) was added and samples were incubated at RT for 10 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... mAb anti-His6 (34650; IF: 1/500) from Qiagen, mAb anti-GAPDH (GTX28245 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse antibodies against the His-tag (1:1000, Qiagen), rabbit antibodies against the C-terminal region of the collagen VI α1 chain (1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reaction conditions were 1 × HotStar® Taq buffer (Qiagen) supplemented with 1.6 mM MgCl2 ...
-
bioRxiv - Neuroscience 2021Quote: ... and diluted 1:50 in TE-Buffer (Qiagen, #1018499) to a final concentration of 1.75e12 vg/ml (kindly donated by I ...
-
bioRxiv - Immunology 2020Quote: ... HIV-1 RNA was isolated using the QIAcube (Qiagen) from mouse plasma using the QIAamp MinElute Virus Spin Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... 1:1,000 dilution of α-His-HRP antiserum (Qiagen), or 1:1,000 dilution of α-OmpA antiserum (Antibody Research Corporation ...
-
bioRxiv - Genomics 2021Quote: ... then 24 mL buffer PB (5:1, Qiagen #19066) and 1.2mL NaOAc were added sequentially ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 U HotStar Taq (Qiagen; based on polymerization activity), and 32 U FEN1 (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA (1 μg) was treated with DNaseI (Qiagen). cDNA was generated using M-MLV Reverse Transcriptase (Invitrogen) ...