Labshake search
Citations for Qiagen :
2001 - 2050 of 4373 citations for 3 4 Hydroxy 5 isopropyl 6 oxo 1 6 dihydro pyrimidin 2 ylsulfanyl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Cells were cultured on a glass substrate and soft hydrogel for 3 days and total RNA was extracted using RNeasy mini kit (Qiagen). RNA quantity and purity were verified using 2200 TapeStation system (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was harvested from 2-3 million HIV-dreGFP infected Jurkat cells exposed to EPZ-719 (500nM) or control (DMSO) using a RNEasy kit (Qiagen). RNA quantity and quality were then analyzed by nanodrop and Tapestation (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... and Chl523R (5’ CCY YMC GTA TTA CCG CAG CT 3’) targeting the 16S rRNA gene on a QIAcuity One digital PCR device (Qiagen) as recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... the FT and Eluate fractions (90 µL each) were mixed with 10 µL 3 M sodium acetate and applied to a QIAquick spin column (Qiagen). Purified DNA was visualized a 1.3% agarose / 0.5x TBE gel and SYBR Green staining ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from cell lines in 3 biological replicates after each CRISPR/Cas9 oncogene downregulation using QIAzol (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... GFP+ and GFP- nuclei were sorted using a BD AriaFACS III (University of Washington Pathology Flow Cytometry Core) into a PCR tube strip containing 3 µL of REPLI-g Advanced Single Cell Storage buffer (Qiagen). Whole genome amplification (WGA ...
-
bioRxiv - Microbiology 2023Quote: ... tissues were placed in 300μL of sterile PBS containing sterile glass beads and mechanically lysed at a frequency of 20 shakes per seconds for 3 minutes in a TissueLyser II (Qiagen). Negative controls consisted of tubes containing PBS and beads but no sample ...
-
bioRxiv - Microbiology 2023Quote: DNA extraction was carried out with 37 mg of freeze-dried mycelium using the Nucleospin Microbial DNA kit in combination with 3 mm tungsten carbide beads (Qiagen) for tissue disruption in a MM 301 vibratory mill ...
-
bioRxiv - Neuroscience 2022Quote: Tissue cultures that were cultivated on one filter membrane (3 cultures) were transferred as one sample into RLT buffer (QIAGEN) and RNA was isolated according to the manufacturer’s instructions (RNeasy Plus Micro Kit ...
-
bioRxiv - Biophysics 2022Quote: ... The liquid culture was then grown for 3 hours at 37°C before the plasmid extraction using a miniprep kit (QIAGEN). Prepared DNA was sequenced by the Microbial Genome Sequencing Center (https://www.seqcenter.com/ ...
-
bioRxiv - Cell Biology 2022Quote: RNA was extracted from cryo-pulverized inguinal adipose tissue from freely-fed 14-day-old mice (n=3 male and female for PTPN23H/H and PTPN23+/+) using the RNeasy Mini Kit (74104; Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... genomic DNA was isolated 3 or 8 days after editing by a QIAamp DNA Mini Kit or Micro Kit (QIAGEN). The genomic region flanking the CRISPR/Cas9 cleavage site was PCR-amplified ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were washed 3 times with PBS to eliminate unbound FVVs and RNAs were extracted using RNeasy plus mini Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... The process was repeated twice (3 in total) and the leukocyte enriched pellet was lysed in 350 µl RLT buffer (Qiagen) and stored at −20 °C ...
-
bioRxiv - Plant Biology 2022Quote: ... The tissue was then ground to a fine powder using 3/16 inch (4.76mm) ball bearings in a Tissuelyzer II (Qiagen, Germany) in the presence of dry ice in the pockets around tube holders ...
-
bioRxiv - Plant Biology 2023Quote: ... the resulting dried leaves were then ground to powder with a 3-mm glass bead placed in a tube with a Tissuelyser mill (Qiagen). The ground samples were incubated at 4°C in DNA extraction buffer (200 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was isolated from 2000 cells per replicate and 3 replicates per treatment by the micro RNeasy kit (QIAGEN) for both mouse muscle satellite cells and ZeMPCs ...
-
bioRxiv - Genetics 2022Quote: RNA from cortex and hippocampus derived ex vivo cultures was extracted from 3 biological replicates for three time points (DIV3, DIV15, DIV31) using RNeasy Plus Mini Kit (Qiagen). cDNA was synthesized using a SuperScript IV Reverse Transcriptase cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... centrifuged to 300 xG for 3 mins and dissociated using RLT buffer as recommended by RNeasy Plus Mini Kit (74134, Qiagen). All RNA isolation steps were done as recommended by the RNeasy kit ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting 1683 bp product spanning the 3’ end of MYO2 upstream of the integration site through the 3’ untranslated region was then isolated using a PCR purification kit (Qiagen), and mutations were confirmed by sequencing using primer 5’- CTCATTTGTGGTGTTTGCTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... BioConcept) in TAE buffer (3-07F03-I, BioConcept) and products were extracted using the QIAquick Gel Extraction Kit (28706, Qiagen) and Sanger sequenced by Microsynth (Balgach ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial cells were harvested from the surface of the cheese agar by using a sterile razor blade and were then immediately placed into 3 mL of RNAProtect Bacteria Reagent (Qiagen) and frozen at -80C until RNA extraction ...
-
bioRxiv - Genetics 2024Quote: RNA was isolated from 10 wandering third-instar larvae (3 biological replicates per genotype; WT, pr-set720 and parp-1C03256) using RNeasy lipid tissue mini kit (Qiagen). RNA samples were flash-frozen in liquid nitrogen and sent to Novogene for library preparation and sequencing ...
-
bioRxiv - Genomics 2024Quote: DNA was extracted from approximately 3 ml of whole blood using the Gentra Puregene Blood Kits (#158467; Qiagen, Hilden, Germany), following the “Whole Blood” subsection in the manufacturer-provided handbook ...
-
bioRxiv - Cancer Biology 2024Quote: ... Final samples of 3 or 30 million cells were collected and genomic DNA was extracted (DNeasy blood and Tissue kit, Qiagen). Next ...
-
bioRxiv - Plant Biology 2024Quote: ... roots or cotyledons) of 3 DAG Arabidopsis seedlings was flash frozen in liquid nitrogen and powdered with TissueLyser machine (Qiagen). RNA was isolated with TRIzol (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: To determine bispecificity of bsAbs his-tagged HCV E2 (3 μg/mL in Tris-buffered saline (TBS)) was immobilized on NiNTA 96-well plates (Qiagen) for 2h at RT ...
-
bioRxiv - Immunology 2024Quote: Reverse transcription and PCR I were performed in 384-well plates pre-loaded with 3 µL of Vapor-Lock (Qiagen). Cell lysis buffer and reverse transcriptase mix (0.4 µL/well ...
-
bioRxiv - Biochemistry 2024Quote: ... NEO1 3’UTR was isolated from genomic DNA isolated from cultured HEK-293T using DNeasy Blood and Tissue kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting homogenates were centrifuged at 13,000 rotations per minute (rpm) for 3 min and RNA in the supernatant was purified using the RNase Mini Kit (Qiagen). A NanoDrop spectrophotometer was used to measure the concentration of RNA in each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... ligated with a single-stranded phosphorylated oligo (to create a 3’-end overhang on template strand) and purified using PCR purification kit (Qiagen). Sequences are listed in Table S1 ...
-
bioRxiv - Microbiology 2024Quote: ... plasmids containing spacer sequences were isolated from 3 mL of overnight culture from each sample with a QIAprep Spin Miniprep Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Genomic DNA was extracted from 3 mm rings surrounding the initial punch wound using DNeasy Blood and Tissue kit (Qiagen). The tissues from a pair of ear pinnae from each animal were pooled prior to DNA extraction so that each DNA sample represented one mouse ...
-
bioRxiv - Biophysics 2024Quote: ... 1.0 mL of culture was extracted from each tube and mixed with 3 mL of RNAprotect Bacteria reagent (Qiagen, Germany) to stabilize cellular RNA ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... were first frozen in liquid nitrogen and then homogenized with a 5 mm ∅ metal bead (Qiagen) for 2 min at 40 Hz using TissueLyser LT (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... using stainless steel beads (5 mm mean diameter) and a TissueLyser LT adapter (Qiagen, Hilden, Germany) for 5 min at 50 Hz ...
-
bioRxiv - Immunology 2021Quote: ... the supernatant/Sepharose bead slurry was passed through a 5 ml polypropylene gravity flow column (Qiagen). The column was washed with 1 column volume of PBS before being eluted with 9 ml of Elution Buffer (0.1M Glycine/HCl buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... and resuspended in 10 mM Tris pH8 (500 μL) with 5 μL RNase A (Qiagen 19101) for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131 ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... was added to the tube together with a 5 mm stainless steel bead (Qiagen, Maryland, USA). The sample was homogenized for two minutes at 30 Hz using a TissueLyser II (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... small RNA-enriched total RNA was treated twice with 5 μl of RNase-free DNase (Qiagen) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Microbiology 2021Quote: ... sorokiniana were ground with two stainless steel beads (5 mm) using a TissueLyser (Qiagen, Hilden, Germany) at 30 Hz for 1 minute at room temperature and soaked in 1 ml of 100 mM sodium acetate buffer pH 5.0 at 70°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 50 mM Tris pH 8.0) using 5 mM stainless steel beads in a TissueLyser II (Qiagen). In vitro TPP1 assay was performed as described ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified lysate was applied to two tandemly-connected 5 ml Ni-NTA Superflow cartridges (Qiagen); the cartridges were washed with buffer containing 20 mM Tris pH 8.0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... sections were incubated in 0.08 M KOH for 5 min and washed by Buffer EB (Qiagen). Then ...
-
bioRxiv - Microbiology 2020Quote: ... The proteolysis reaction products were then passed over a 5 mL Ni-NTA superflow cartridge (Qiagen) to remove TEV and uncleaved protein ...