Labshake search
Citations for Qiagen :
151 - 200 of 2481 citations for 3' Methyl 1 1' biphenyl 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... single-end BS-seq libraries were also constructed with Ovation Ultralow Methyl-Seq Library Systems (Nugen, 0336) and EpiTect Bisulfite Kit (Qiagen, 59104) kits according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Further confirmation of which allele was deleted in clones with only one UBE3A copy was performed by utilizing the EpiTect Methyl II DNA Restriction Kit (QIAGEN, #335452) to measure methylation at the PWS-IC (SNRPN ...
-
bioRxiv - Cell Biology 2023Quote: ... snap frozen samples were homogenized in an Eppendorf tube using a 3-mm Tungsten carbide beads and TissueLyser II system (Qiagen; 4 min at 30 Hz). RNA isolation steps were followed as mentioned above in this section ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-TGGTTCTACATCAGAGTTGTT-3’ (Qiagen). Lentiviral particles expressing SMART vectors doxycyclin-inducible shRNA were from Dharmacon as follows ...
-
bioRxiv - Genomics 2020Quote: ... purified nucleic acids were treated with 1-5 μl 1 mg/ml RNaseA (Qiagen) for 45 minutes at 37 °C to degrade RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 30 uL/well 1 X lysis buffer (1x Qiagen TCL, 1% beta-mercaptoethanol) was added ...
-
bioRxiv - Biophysics 2022Quote: ... The YB-1 (1-180) protein fragment was purified following the manufacturer’s recommendations (Qiagen). Briefly ...
-
bioRxiv - Biophysics 2022Quote: ... supernatant was combined with Ni-NTA resin (1 mL/1 L of biomass, Qiagen) pre-equilibrated with 20 mM HEPES ...
-
bioRxiv - Genomics 2023Quote: ... slides were treated with 1 mg/ml RNase A (1 mg/ml, Qiagen, 19101) in 2x SSC for at least 45 min at 37°C and then dehydrated in a 70% ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1× QuantiNova RT Mix (Qiagen), 1× QuantiNova SYBR Green RT-PCR Master mix ...
-
bioRxiv - Microbiology 2021Quote: ... Strep 1:1000 (Qiagen, 34850).
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μM oligo-dT18 (Qiagen) and 10 μM random hexamers (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... 1% SDS (Qiagen P2 buffer). Neutralize lysis buffer by adding 300 μL of 4.2 M Guanidine HCl ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μl of DNase (Qiagen) was added ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of QIAzol (Qiagen) was added to each pellet suspension before being transferred to Lysing Matrix B tubes (MP Biomedicals) ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μM TSO (Qiagen). The master mix was dispensed using the MANTIS liquid dispenser followed by mixing for 1 min at 1800 rpm on a plate shaker (Biosan) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 U Hotstar Taq (Qiagen), 1X Hotstar Taq buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% SDS (Qiagen P2 buffer). Neutralize lysis buffer by adding 300 μL of 4.2 M Guanidine HCl ...
-
bioRxiv - Immunology 2024Quote: ... 1 mL RLT Buffer (Qiagen) was added to the thawed lungs ...
-
bioRxiv - Microbiology 2022Quote: ... 27620, 1:2,000 dilution) (rabbit anti-Spike S1, Cell Signaling, Cat #: 99423, 1:2,000 dilution) (mouse anti-Strep, Qiagen, Cat #: 34850, 1:2,000 dilution) (rabbit anti-ORF8 ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...
-
bioRxiv - Bioengineering 2024Quote: ... the 3×Flag-MCS fragments in LV3-SFFV-3×Flag-MCS-GFP (QZ35395, QIAGEN) was replaced by DreAM though NotI and SpeI sites to produce the LV3-SFFV-DreAM-GFP plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Systems Biology 2024Quote: ... NTA-agarose resin (1 mL) (Qiagen) was washed twice with 3 ml of distilled water and 2 ml of 100 mM FeCl3 in 0.1% acetic acid was added ...
-
bioRxiv - Developmental Biology 2024Quote: ... SFPQ siRNA #1 (Qiagen Cat#SI05783848), and SFPQ siRNA #2 (Qiagen Cat#SI05783876 ...
-
bioRxiv - Plant Biology 2024Quote: ... mixed with 1% beta-mercaptoethanol (Qiagen) using Kimble Chase glass tissue grinders (part# KT885450-0020) ...
-
bioRxiv - Neuroscience 2022Quote: ... and samples were diluted 1:1 in 70% ethanol and purified using RNeasy columns and reagents (QIAGEN). RNA concentration was measured using a NanoDrop spectrophotometer ...
-
bioRxiv - Systems Biology 2022Quote: ... 12 μl of 1 M Tris-HCl (pH 6.5) and 1 μl RNAse A (Qiagen cat # 19101) were added to the sample and incubated for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Microbiology 2024Quote: ... approximately 1 × 109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Small pieces of tissue (~1×1 mm) were minced and placed in RLT Plus buffer (QIAgen, 1053393) supplemented with 140 mM 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mL of stabilization mix (RNAprotect Bacteria Reagent - Qiagen diluted with PBS in a 2:1 volume ratio) was applied on plates ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned-up using 1:1 of SPRI beads and eluted in 30µl elution buffer (Qiagen). The resulting amplicons were assayed on the Fragment Analyzer System (Agilent) ...