Labshake search
Citations for Eurogentec :
1 - 29 of 29 citations for pVectOZ CAT Transfection control since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... were purchased from Dharmacon or Wnt5a siRNA (Cat no.-SR-NP001-001) and control siRNA (Cat no.-SR-CL000-005) were purchased from Eurogentec. cDNA synthesis kit (Cat no.-BB-E0045 ...
-
bioRxiv - Cell Biology 2024Quote: ... Control cells were electroporated with a scramble siRNA (siRNA-negative control duplex; Eurogentec).
-
bioRxiv - Cell Biology 2021Quote: ... control siRNA (Eurogentec, SR-CL000-005); for human SphK2 5’ GCUGGGCUGUCCUUCAACCU 3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... using Lipofectamine RNAiMAX (Invitrogen #11668-019)-siRNA transfection (siCtr – Eurogentec SR-CL011-005). SiRNA targeting sequences for human Nme1 and Acly are reported in the key resources table.
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transfection of siRNAs (Eurogentec, Belgium; Table S2) was performed using Lipofectamine RNAimax (ThermoFischer Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... For Control: Scrambled siRNA (Eurogentec SR-NP001-001) or siGENOME Non-Targeting Pool #1 (Dharmacon ...
-
bioRxiv - Cell Biology 2022Quote: ... Targeting and control siRNAs were synthesized by Eurogentec, Belgium ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cyp1b1 or a negative control siRNA (Eurogentec, Belgium) were done using Lipofectamine RNAiMAX reagent (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... hGBF1 (5’- CCUCUGUCAACAAGUUCCU-3’) and control siRNA was purchased from Eurogentec. Following plasmids used in this study were described previously ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected using Interferin (Polyplus Transfection) with siRNA oligonucleotide duplexes (Eurogentec, Belgium). The sequences of the siRNA duplexes were ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5μl of 10pmoles/μl of internal control forward primer (MS2) (supplied by Eurogentec), 0.5μl of 10pmoles/μl internal control reverse primer (MS2) ...
-
bioRxiv - Biophysics 2023Quote: ... cavin-1/PTRF (L-012807-02-0005) or control RNAi SR-CL000 (Eurogentec) was used at 100 nM via magnetofection technology (OZ Biosciences ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 15 Synthetic S100 and control peptides were custom-made by commercial suppliers (Eurogentec, GeneScript and Bachem) and sequences are given in Figure 1A ...
-
bioRxiv - Developmental Biology 2020Quote: ... Non-targeting control siRNA and siRNA duplexes targeting Sorbs1 (5’-UUAAGUCCUGAGUGCUCUUC-3’) were synthesized and purchased from Eurogentec.
-
bioRxiv - Genetics 2020Quote: ... and random probe (negative control) were adapted from Chu et al.’s paper 18 (sequences in “Supplementary file”) and manufactured by Eurogentec. The method is summarised as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... hepatica cathepsin L1 pro-peptide (rFhCL1pp; 1:500 dilution, non-related control) and pre-immune anti-rFhCL1pp (1:500 dilution) (Eurogentec). Parasite sections were incubated at RT for five hours in a humid container ...
-
bioRxiv - Microbiology 2021Quote: ... 480-496 aa (Eurogentec; Cat. No: As-656-19). Plates were washed ...
-
bioRxiv - Synthetic Biology 2022Quote: ... with Highlighter plasmids in 1 mm electroporation cuvettes (Eurogentec, Cat#CE-0001-50) using an Eppendorf Multiporator (Cat#4308 ...
-
bioRxiv - Genomics 2020Quote: ... 1.25 µl of mouse anti-human 5mC antibody (clone 33D3; Eurogentec Ltd., Cat No. BI-MECY, RRID:AB_2616058), and 10 µl of Dynabeads coupled with M-280 sheep anti-mouse IgG bead (Invitrogen) ...
-
bioRxiv - Plant Biology 2023Quote: ... by using the Takyon No ROX SYBR MasterMix blue dTTP kit (Cat. No. UF-NSMT-B0701; Eurogentec). Each amplification reaction was set up in a 10-μl reaction containing each primer at 300 nM and 1 μl of RT template in the case of total RNA with a thermal profile of 95°C for 10 min and 40 amplification cycles of 95°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Two tubes were hybridized overnight with 0.5μg/ml of Cy5-labeled G-rich telomere probe (Cat.#PN-TG055-005, Eurogentec) and two tubes were used as unlabeled control ...
-
bioRxiv - Developmental Biology 2024Quote: ... qRT-PCR was performed using Takyon Rox SYBR 2x Master mix blue dTTP kit (Eurogentec Cat# UF-RSMT-B0701), with starting concentrations of template of around 10ng/µl and primer concentrations of 0.5µM ...
-
bioRxiv - Cancer Biology 2024Quote: ... Female Rag2−/− mice infused with Marilyn T-ALL cells were treated intraperitoneally once a week for two weeks with 0.01 mg of DBY peptide (NAGFNSNRANSSRSS; cat. no. AS-61046; Eurogentec).
-
bioRxiv - Developmental Biology 2021Quote: ... PCR amplification was performed using MESA Green qPCR MasterMix for SYBR assay (Cat. No. RT-SY2X-03+WOUN, Eurogentec, Ltd.) on a DNA Engine Opticon2 thermocycler (BioRad) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... RT-qPCR was performed on the Stratagene 500 MX3005P using a SYBR Green reaction mix (Eurogentec, Cat#10-SN2X-03T). The primers used for mRNA detection of target genes by RT-qPCR are listed in Table S1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The genomic DNA was purified from the hippocampal region of the brain tissues (∼10-12mg) using the smart extract-DNA extraction kit as per the supplier’s instruction (Cat# SKDNEX-100, Eurogentec, Belgium). The quantity of total genomic DNAs (gDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... membranes were blocked in 5% milk PBS-T (1X PBS buffer with 0.1% Tween-20) and incubated overnight at 4°C with one of the following antibodies: anti-HA.11 (1:2,000; Eurogentec, Cat# MMS-101P-500), anti-Stm1 (1:10,000 ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... qPCR was done using an Applied Biosystems 7500 Fast Instrument with Quantitation -Standard Curve experimental type and Takyon Low ROX SYBR 2X MasterMix blue dTTP (Eurogentec cat# UF-LSMT-B0710) using three-step protocol for optimal sensitivity and 45 cycles in total ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RT-qPCR amplification was carried out with the dsDNA-specific dye Takyon™ SYBR® 2X qPCR Mastermix Blue (Eurogentec Cat#UF-FSMT-B0701) and monitored in real-time with a LightCycler 480 instrument (Roche) ...