Labshake search
Citations for Eurogentec :
1 - 42 of 42 citations for Recombinant Human Angiopoietin 2 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The proteins were injected into rabbits to generate polyclonal antibodies according to standard protocols (His-GspD, Cocalico, Reamstown, PA; His-PilQOlut, Eurogentec, Seraing, BE). Sera were tested for cross-reactivity by immunoblotting lysates from wildtype M ...
-
bioRxiv - Plant Biology 2019Quote: ... The purified recombinant protein was used to immunize rabbits by a company (Eurogentec). From the immunserum a crude IgG fraction was isolated by ammonium sulfate precipitation then IgG was further purified on protein gel blots of the antigen ...
-
bioRxiv - Genetics 2019Quote: ... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... HA tagged proteins were labeled overnight at 4°C with the mouse HA.11 Clone 16B12 Monoclonal Antibody (Eurogentec) 1/2000 in PBS + tween 0.2% (v/v ...
-
bioRxiv - Microbiology 2021Quote: Rabbits were immunized with recombinant ACS according to the manufacturer’s standard procedures (Eurogentec, Seraing, Belgium). Reactivity of serum was compared to pre-immune serum using an enzyme-linked immunosorbent assay ...
-
bioRxiv - Plant Biology 2020Quote: ... the membrane was incubated with a rabbit polyclonal antiserum raised against recombinant ATC (Eurogentec, Belgium) for 1 h ...
-
bioRxiv - Plant Biology 2022Quote: ... the membrane was incubated with a rabbit polyclonal antiserum raised against recombinant ATC (Eurogentec, Belgium) for 1 h ...
-
bioRxiv - Cell Biology 2023Quote: Purified recombinant TbSmee1(1-400) was used for the generation of two polyclonal rabbit antisera (Eurogentec). Antisera (303 ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 1 µM human gp100 (25-33) (Eurogentec) and 50 U/mL IL-2 (PeproTech ...
-
bioRxiv - Cell Biology 2024Quote: Anti-TbMyo1 antibodies were generated by immunisation of two rabbits with purified recombinant TbMyo1 (amino acids 729–1,168) (Eurogentec). For recombinant protein expression the TbMyo1 tail was cloned into a pET-28a(+ ...
-
bioRxiv - Plant Biology 2022Quote: ... SCOOP10#2* (GDIFTGPSGSGHGGGRTPAP) corresponding to SCOOP10#2 without hydroxyprolines was obtained from Eurogentec SA (Seraing ...
-
bioRxiv - Neuroscience 2020Quote: ... was induced in 8-week-old female SJL/J mice via subcutaneous immunization with 200 μg recombinant myelin proteolipid protein (PLP139-151, Eurogentec) in an emulsion mix (volume ratio 1:1 ...
-
bioRxiv - Biochemistry 2021Quote: Localization studies were carried out using a rat antibody raised against purified recombinant Pf-int (aa 192-490) (Eurogentec, Belgium). Fixed parasites were spotted in each well of the microscopy slide and air-dried at RT in order to allow the parasites to adhere ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The purified recombinant protein was then used as an antigen in an 87 days immunization program on Guinea pigs (outsourced to Eurogentec). The DMC1 antibody was then purified from antisera following affinity purification (using Affi-Gel 15 from Biorad ...
-
bioRxiv - Cell Biology 2023Quote: Recombinant full-size proteins were used to immunise different animals (Pineda, Berlin, Germany; Davids Biotechnology, Regensburg, Germany; Eurogentec, Seraing, Belgium). The resulting antisera were affinity purified against the immobilised recombinant protein ...
-
bioRxiv - Biochemistry 2021Quote: Western blot analyses were carried out using a rat antibody raised against purified recombinant Pf-int (aa 192-490) (Eurogentec, Belgium). The protein content was transferred to a nitrocellulose membrane using the Trans Blot Turbo (BioRad ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA 2 5’ GCCCUAUCCCUUUACGUCA (Eurogentec). Dharmacon ONTarget plus SMARTpool ...
-
bioRxiv - Cell Biology 2023Quote: ... TaqMan 2× Mastermix Plus – Low ROX (Eurogentec), and the related TaqMan assays together with 8 µl of the diluted DNA samples (n=3) ...
-
bioRxiv - Immunology 2021Quote: Immunising and screening peptides are outlined in S.Table 2 (Figure 3-figure supplement 2) and were synthesized by Eurogentec (Belgium). A portion was further conjugated to Key Lymphocyte Haemoglutinin (KLH ...
-
bioRxiv - Immunology 2022Quote: ... and TRAC or TRBC1/2 specific primers (Eurogentec) (see Supplementary file 5 for primer list) ...
-
bioRxiv - Cell Biology 2023Quote: ... and TaqMan 2× Mastermix Plus – Low ROX (Eurogentec) on a ViiA 7 thermocycler (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: DNA sequences (Table 2) were supplied by Eurogentec (Belgium), synthesized on a 1000 nmol scale and purified by reverse phase HPLC ...
-
bioRxiv - Genomics 2020Quote: ... 1.25 µl of mouse anti-human 5mC antibody (clone 33D3; Eurogentec Ltd., Cat No. BI-MECY, RRID:AB_2616058), and 10 µl of Dynabeads coupled with M-280 sheep anti-mouse IgG bead (Invitrogen) ...
-
bioRxiv - Plant Biology 2023Quote: Biotinylated peptides (synthetized by Eurogentec, sequences shown in Fig. 2) were mostly insoluble in water and were thus resuspended in 6 M urea ...
-
bioRxiv - Molecular Biology 2022Quote: ... Anti-DHX34 is a peptide-specific antibody raised against human DHX34 obtained from Eurogentec (Hug and Cáceres 2014). For Immunopurifications GFP-Trap-MA beads (Chromotek ...
-
bioRxiv - Genetics 2019Quote: ... The purified protein was used to immunize 2 rabbits (Eurogentec, Belgium), and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec) ...
-
bioRxiv - Cell Biology 2023Quote: The anti-M6 antiserum #2 was generated by immunizing guinea pigs (Eurogentec) with the peptides GKGNNRDRIRDPRE and RRNSYRSDHSLDRYT (corresponding to aa 57–71 and 102–116 in M6 isoform F ...
-
bioRxiv - Biophysics 2019Quote: ... and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley, UK) and 6-bromoacetyl-2-dimethylaminonaphthalene (BADAN) from EUROGENTEC (Southampton, UK). N-(2-(iodoacetamido)ethyl)-7-diethylaminocoumarin-3-carboxamide (IDCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.3 mg of protein was used per rabbit for immunization of 2 rabbits (Eurogentec). Serum collected from one rabbit was affinity purified against GST-ATI11-180 ...
-
bioRxiv - Molecular Biology 2021Quote: ... using 2 μl of the diluted cDNAs (1:5) and Takyon Blue Master Mix (Eurogentec). All primers used are listed in Table S9 ...
-
bioRxiv - Genomics 2022Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by peptide affinity column ...
-
bioRxiv - Genomics 2023Quote: Antibodies against H2A.Z.11 (KGLVAAKTMAANKDKC) and H2A.2 (CPKKAGSSKPTEED) peptides were raised in rabbits (Eurogentec) and purified by a peptide affinity column ...
-
bioRxiv - Neuroscience 2023Quote: ... Capture antibodies were: our previously described custom rabbit anti-(GR)7 antibody (Eurogentec 2 µg/mL) 90 ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Microbiology 2021Quote: ... and the products were run on a 2% agarose gel at 100 V for 30 mins alongside the 100-1000 bp DNA Ladder (SmartLadder-SF, Eurogentec).
-
bioRxiv - Biochemistry 2023Quote: ... C+IVAPGEARLGSIKMA for bGIC-1 and C+TAAEGRISGMAIAKS for bGIC-2) were generated as a N-terminal Keyhole limpet haemocyanin fusion to raise the antibodies in rabbits (Eurogentec). For Western blots ...
-
bioRxiv - Microbiology 2024Quote: An amount of 2 μL of cDNA was then used for quantitative PCR with the MESA GREEN qPCR MasterMix Plus (Eurogentec) and primers for AID (Forward 5′ AATTCAAAAATGTCCGCTGGGC*T3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Metaphases were denatured at 72°C in 70% formamide/30% 2xSSC solution for 2 min before hybridization to Alexa 488–OO-(CCCTAA)n probe (Eurogentec) at 37°C for 16 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... Relative copy numbers of the single-copy nuclear-encoded gene beta-2-microglobulin (β2M) and the mitochondrially-encoded gene mtND1 were measured by quantitative (Q)-PCR using SYBR Green Mastermix (Eurogentec Ltd.) and the DNA Engine Opticon 2 system (BioRad) ...
-
bioRxiv - Immunology 2020Quote: ... The expression of the genes of hexokinase 2 (HK2) and LDH-A was determined using PCR SYBR Green sequence detection system (Eurogentec, Seraing, Belgium) and the CFX Connect™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... and each sample was run in triplicate with 2 µL of the diluted cDNA and 8 µL of master mix containing 1x qPCR MasterMix Plus Low ROX (Eurogentec, Liège, Belgium) or 1x TaqMan gene expression MasterMix (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... in a final volume of 10 µL (0.5 µL of each primer, 5 µL of Eurogentec Takyon™ SYBR® 2 x qPCR Mastermix Blue). The following Light-Cycler run protocol was used ...