Labshake search
Citations for TriLink BioTechnologies :
1 - 41 of 41 citations for Glyphosate Chemical Purity 96% 2 13C 99%; 15N 98%+ 1000 Ug Ml In Water since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and CpG 2 µg/ml (TriLink) were added in a final volume of 100 µl ...
-
bioRxiv - Cell Biology 2020Quote: ... T cells were electroporated with 15 ug Cas9 mRNA (TriLink) and 10 ug AAVS1 specific sgRNA using the Neon electroporator (3×105 in 10ul Neon tip ...
-
bioRxiv - Microbiology 2021Quote: ... sgRNA (20ng/ul) was microinjected with Cas9 mRNA (50ng/ug purchased from TriLink BioTechnologies) into the cytoplasm of fertilized eggs collected from C57BL/6N mice (Charles River Laboratory) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 mM 2’F-Py (2’F-2’-dCTP and 2’F-2’-dUTP, TriLink Biotechnologies), 1 mM ATP ...
-
bioRxiv - Bioengineering 2020Quote: ... 2’-Fluoro-2’-deoxycytidine-5’-Triphosphate (2’F-dCTP) and 2’-Fluoro-2’-deoxyuridine-5’-Triphosphate (2’F-dUTP) were purchased from Trilink Biotechnologies ...
-
bioRxiv - Neuroscience 2021Quote: ... which were then plated at 500,000 cells per well in a Matrigel-coated 6-well plate for transfection with 1.2 ug of Cre recombinase mRNA (TriLink Biotechnologies cat. no. L-7211) using Lipofectamine Stem to remove the puromycin resistance gene and mCherry ...
-
bioRxiv - Biochemistry 2020Quote: ... and 2’-Azido-2’-dATP (TriLink BioTechnologies, San Diego, California) in 20 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Neuroscience 2022Quote: ... or Cas9 mRNA (1000 ng/μl) (TriLink BioTechnologies), sgRNA (30 ng/μl ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2’-fluoro modified CTP and 2’-fluoro modified UTP (TriLink Biotechnologies). All RNA aptamers were purified through denaturing polyacrylamide gel electrophoresis (0.75 mm ...
-
bioRxiv - Cancer Biology 2024Quote: ... Modified aptamers that carried both 2’FY and 2’OMeR were purchased from TriLink BioTechnologies (San Diego ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 0.02ug or 0.002ug replicon mRNA (capped and polyAdenylated) diluted in nuclease-free water or with 1ul FLuc mRNA (Trilink). Prog ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Zbtb46 ORF sequence “ATGAACAACCGAAAGGAAGATATGGAAATCACTTCTCACTACCGGCATCTGCTTC GAGAGCTCAATGAGCAGAGGCAGCACGGAGTCCTCTGTGATGCGTGCGTCGTGG TGGAGGGCAAGGTCTTCAAGGCACATAAGAACGTCTTGCTTGGGAGCAGCCGCTA CTTTAAGACGCTCTACTGCCAGGTACAGAAGACATCTGACCAGGCCACCGTCACT CACTTGGACATTGTTACAGCCCAGGGCTTCAAGGCCATTATTGACTTCATGTACTC CGCCCATCTGGCTCTCACTAGTAGGAATGTCATCGAGGTGATGTCAGCTGCCAGC TTCCTACAGATGACTGACATTGTGCAGGCCTGCCATGATTTCATCAAGGCTGCACT GGACATCAGCATAAAGTCAGATGCCTCCGATGAACTCTCAGAATTTGAGATTGGCA CCCCAGCCAGCAACAGTACAGAGGCGTTGATCTCAGCTGTGATGGCTGGAAGGAG TATCTCCCCATGGTTGGCTCGGAGAACAAGTCCTGCCAATTCTTCTGGAGACTCTG CCATTGCCAGCTGTCATGAAGGAGGAAGCAGCTATGGGAAGGAGGACCAGGAAC CCAAAGCTGATGGCCCTGATGACGTTTCTTCACAGTCTTTGTGGCCTGGAGATGTA GGCTATGGGTCTCTGCGCATCAAGGAAGAACAGATTTCACCATCACATTATGGAGG GAGTGAGCTTCCATCTTCCAAGGACACTGCAATACAGAATTCTTTATCAGAACAGG GTTCTGGGGATGGCTGGCAGCCCACAGGCCGGAGGAAGAATCGGAAAAACAAAG AGACTGTCCGACACATCACCCAGCAGGTGGAGGAGGACAGCCAGGCTGGCTCTC CAGTACCTTCATTCCTACCCACATCGGGATGGCCTTTCAGCAGCCGAGACTCAAAT GTAGACCTGACGGTCACTGAGGCCAGCAGCTTGGACAGCCGAGGCGAGAGAGCA GAGCTCTATGCTCACATCGATGAGGGCCTACTAGGAGGAGAAACCAGCTACTTGG GCCCACCCCTCACCCCAGAGAAGGAAGAAGCACTACACCAGGCTACTGCAGTGG CCAATCTTCGTGCTGCACTCATGAGTAAGAACAGTCTGCTGTCACTCAAGGCTGAC GTGCTCGGTGATGATGGCTCACTTCTGTTCGAGTACCTGCCCAAAGGTGCCCACT CACTGTCTCGTAAGTGCAAGTTCTGGTGTGTCACTGTGTCTTCCTTTGGTTTAAGCA CCTCAGTTCAGCCCTTCAGACCCTGGAGTCACTGA” was made into a modified mRNA transcript with complete substitution of pseudo-U in RNase-free water from TriLink Biotechnologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2’-fluoro-dNTPs were from TriLink BioTechnologies ...
-
bioRxiv - Microbiology 2020Quote: ... 2’-F-2’-dUTP (N-1010-1) and didanosine-TP (N-4017-1) were purchased from Trilink. Remdesivir-DP was synthesized by WuXi AppTech ...
-
bioRxiv - Biochemistry 2020Quote: ... SH-SY5Y cells were electroporated or chemical transfected with commercially available non-labeled (NL) or Cyanine5-labeled (Cy5) eGFP encoding mRNAs (Trilink®) has described here.
-
bioRxiv - Molecular Biology 2022Quote: ... the 3’-end azide functionalization in presence of 2’-azido-2’-deoxyadenosine-5’triphosphate (ATP-azide, Trilink Biotechnologies) using yeast poly(A ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 8-oxo-2’-deoxyguanosine-5’-triphosphate (8-oxo-dGTP) and 2’-deoxy-P-nucleoside-5’-triphosphate (dPTP) (TriLink). For each library ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μM dPTP (TriLink BioTechnologies; N-2037), and 2.5 U Taq polymerase in Thermopol Reaction Buffer (New England Biolabs ...
-
bioRxiv - Cancer Biology 2019Quote: 2’O-methyl SSOs were provided by Trilink BioTechnologies ...
-
bioRxiv - Biochemistry 2020Quote: ... and 2’-Azido-UTP were purchased from Trilink BioTechnologies (San Diego ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μM 8-oxo-dGTP (TriLink BioTechnologies, N-2034), 2 μM dPTP (TriLink BioTechnologies ...
-
bioRxiv - Immunology 2023Quote: ... were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Firefly luciferase mRNA (Cat. No. L-7702-1000) was obtained from Trilink Biotechnologies (San Diego ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2’ O-methyl phosphorothioate AOs were synthesised by TriLink BioTechnologies (San Diego CA ...
-
bioRxiv - Immunology 2021Quote: ... 2 μg of the RBD-his mRNA or GFP mRNA (Trilink) was formulated in 6.6 μl of PBS pH 5.5 with 1.37 μl of 5mM CART and added to the cells ...
-
bioRxiv - Bioengineering 2022Quote: ... however 2 μl of the appropriate canonical NTP (75 mM) was replaced by 2 μl of 100 mM 5-Hydroxymethyl-5’-triphosphate (e.g. 5-Hydroxymethyl-CTP) (TriLink).
-
bioRxiv - Cancer Biology 2023Quote: The long strand of the AsiC synthesized with 2′-fluoropyrimidines was annealed to the short antisense strand (TriLink Biotechnologies) with a 2-fold molar excess of the short strand ...
-
Evaluation of mRNA-LNP and adjuvanted protein SARS-CoV-2 vaccines in a maternal antibody mouse modelbioRxiv - Immunology 2023Quote: ... diproline-modified spike protein from the SARS-CoV-2 Wuhan-Hu-1 strain were produced as previously described15,16 with m1Ψ-5-triphosphate (TriLink) instead of UTP and capped cotranscriptionally using the trinucleotide cap1 analog ...
-
bioRxiv - Molecular Biology 2019Quote: ... which was used to attach Cy3B/BHQ-2 labeled DNA oligonucleotides via RNA/DNA hybridization (labeled DNA oligonucleotides purchased from TriLink Technologies). Individual tRNA species used were purchased from Chemical Block Ltd ...
-
bioRxiv - Immunology 2021Quote: Short mitochondrial DNA fragments (221bp) were amplified from gDNA from A549 cells with and without 8-Oxo-2’-deoxyguanosine-5’-Triphosphate (TriLink Biotechnologies) using GoTaq Mastermix ...
-
bioRxiv - Genomics 2022Quote: ... 19uL of the solution was combined with 1.5uL 10mM dATP-NH2 (7-Deaza-7-Propargylamino-2’-deoxyadenosine-5’-Triphosphate from Trilink N-2068), 8.0uL 3.75mM 2kD Biotin-PEG-NH2 (Laysan Bio Item# Biotin-PEG-NH2-2K-1g ...
-
bioRxiv - Molecular Biology 2022Quote: ... a fixed total RNA volume of 2 μl was used for library preparation using the CleanTag kit (TriLink, San Diego, USA). Adapter dilution (1:4 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Equal volumes of total RNA (2 μL) were used for small RNA library preparation using the Clean Tag small RNA library preparation kit (TriLink Biotechnologies, US). that utilizes chemically modified adapters to prevent formation of adapter dimers 53 ...
-
bioRxiv - Bioengineering 2022Quote: ... IVT reactions performed as described for unmodified with 2 μl of the appropriate unmodified 75 mM NTP replaced by 5 μl of 10 mM Sp α-thiophosphate NTP (Biolog) or 2 μl 100 mM Rp/Sp α-thiophosphate NTP (TriLink).
-
bioRxiv - Biochemistry 2020Quote: ... but with a dNTP mixture in which ATP and CTP were completely substituted with 2-amino-dATP and 5-propynyl-dCTP (TriLink Biotechnologies, San Diego, CA). Template DNA was then precipitated ...
-
bioRxiv - Immunology 2023Quote: ... The adjuvanted microsphere vaccine formulation contained 3 µg/mg of survivin-specific class 1 and class 2 peptides and 0.5 µg/mg of the TLR-9 oligonucleotide agonist CpG (ODN-1018) (Trilink Biosciences, San Diego, CA, USA). The microspheres ...
-
bioRxiv - Systems Biology 2019Quote: eGFP mRNA and eGFP mRNA with Cy5 label nucleotides (996 nucleotides, 1 mg/mL in 10 mM Tris-HCl and pH 7.5) were purchased from TriLink Biotechnologies ...
-
bioRxiv - Synthetic Biology 2024Quote: ... transduced activation reporter cells were enriched by puromycin selection (1µg mL-1) following nucleofection of dCas9-VPR mRNA (TriLink) and a Cas9 sgRNA targeting the ESR protospacer (IDT) ...
-
bioRxiv - Microbiology 2020Quote: ... Virus was plaque-purified on Vero CCL81 cells in the presence of 25 μg/ml of cytosine arabinoside (TriLink BioTechnologies), and plaques in agarose plugs were amplified on Vero CCL81 cells ...
-
bioRxiv - Bioengineering 2019Quote: ... each sample was mixed in a 1.5mL tube with the appropriate volume of EGFP mRNA (996 nucleotides translated into a 26.9 kDa protein, 1 mg mL−1 L-7601, TriLink BioTechnologies) at final concentrations ranging from 10 μg mL−1 to 160 μg mL−1 (30 nM to 473 nM) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5 × 104 cells were harvested and incubated in 10 ml Neon Buffer R with 1 ul (1ug/ul) of Clean-Cap Cas9 mRNA (TriLink Biotechnologies) and 1 ul (100 pmol/ul ...
-
bioRxiv - Molecular Biology 2021Quote: Cell lysates were prepared and 12 fractions were collected from polysomes fractionated using the protocol for riboseq gradient preparation above (without nuclease treatment.) 0.3 ml of each gradient fraction was spiked with equal amounts of control RNA (Fluc mRNA, Trilink Biotechnologies, USA), then total RNA was extracted using the hot acid phenol-chloroform method (34) ...