Labshake search
Citations for TriLink BioTechnologies :
51 - 80 of 80 citations for n1 Alpha L arabinopyranosylamino guanidine hno3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Cas9 mRNA (100 ng/uL. Trilink, L-6125) and both sgRNAs (100 ng/uL each ...
-
bioRxiv - Microbiology 2021Quote: Empty LNPs (eLNPs) and luciferase mRNA (TriLink, #L-7202)-loaded LNPs (LNP-Luc mRNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... 200 ng CleanCap Cas9 (5moU) mRNA (Trilink, L-7206) was electroporated into the cells using the Neon™ Transfection System (ThermoFisher) ...
-
bioRxiv - Immunology 2024Quote: ... GFP mRNA (catalog number L-7601) was purchased from TriLink Biotechnologies ...
-
bioRxiv - Immunology 2024Quote: 1 mg of CleanCap® FLuc mRNA (TriLink; L-7602) was pre-mixed by pipetting ...
-
bioRxiv - Neuroscience 2020Quote: ... Commercial Cas9 mRNA was ordered from TriLink (L-6125, San Diego, CA) and used for the embryo microinjection ...
-
bioRxiv - Developmental Biology 2024Quote: ... A mixture of Cas9 mRNA (50 ng/ µl, #L-6125, TriLink Biotechnologies) and two specific gRNAs (25 ng/ µl each ...
-
bioRxiv - Immunology 2023Quote: ... transduced TIL5746 were electroporated with Cas9 mRNA (Trilink #L-7206, lot# T1COL01A) using an Amaxa 4D-Nucleofector unit and pulse code CA137 with Buffer P3 according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... RNP complexes were supplemented with 500 ng EGFP mRNA (Trilink Biotechnologies, L-7201) per well ...
-
bioRxiv - Genetics 2020Quote: ... 2E5 cells were transfected with 500ng of GFP mRNA (TriLink Biotechnologies, cat# L-7201) or RNP using a 96-well Shuttle nucleofector (Lonza ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries were prepared using the CleanTag Small RNA Library Preparation Kit (TriLink, L-3206) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Cas9 was then introduced using nucleofection of CleanCap 5moU Cas9 mRNA (Trilink, #L-7206). For base-editing experiments ...
-
bioRxiv - Genetics 2021Quote: ... both sgRNAs (20 ng/µl each) and Cas9 mRNA (50 ng/µl, TriLink Biotechnologies, L-7206) were injected into the pronucleus and cytoplasm of fertilized eggs (Transgenic Animal Modeling Core ...
-
bioRxiv - Cell Biology 2023Quote: ... incubated with the CleanCap® EGFP mRNA (#L-7601-100; TriLink Biotechnologies, San Diego, CA, USA) for the indicated times ...
-
bioRxiv - Immunology 2023Quote: ... were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Firefly luciferase mRNA (Cat. No. L-7702-1000) was obtained from Trilink Biotechnologies (San Diego ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 30 pg - 1 ng of eGFP spike-in RNA (TriLink Biotechnologies L-7601-100), vortexed ...
-
bioRxiv - Immunology 2023Quote: ... a spike-in mRNA standard was added at this step (CleanCap EGFP mRNA from TriLink, L-7601) to account for RNA loss during processing ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the wget command (http://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_38/gencode.v38.transcripts.fa.gz) and the sequence for the eGFP spike-in (TriLink L-7601) was manually appended to the reference transcriptome (https://www.trilinkbiotech.com/media/folio3/productattachments/product_insert/egfporf_catno_l-7201_l-7601_l-7701_.txt).
-
bioRxiv - Bioengineering 2024Quote: ... small RNA libraries are constructed with the CleanTag Small RNA Library Preparation Kit (TriLink, Cat# L-3206) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... and/or Clean Cap®Cyanine5 (Cy5) Enhanced Green Fluorescent Protein mRNA (5-methoxyuridine) (TriLink Biotechnologies, L-7701).
-
bioRxiv - Microbiology 2020Quote: ... rRNA depleted samples were prepared for sequencing using the Cleantag Small RNA library prep kit (Trilink, L-3206-24) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... sgRNA sequences (20 ng/μL) and its corresponding donor oligonucleotide (100 ng/μL) were co-microinjected with Cas9 nickase mRNA (50 ng/μL, Trilink Biotechnologies) into the cytoplasm of zygotes collected from B6D2F1/J mice (JAX #100006) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions testing IRES nLuc reporters were additionally supplemented with 50 ng/µL (final) competitor FFLuc mRNA (TriLink Biotechnologies # L-7602-100) to increase the fidelity of the IRES nLuc signal ...
-
bioRxiv - Molecular Biology 2024Quote: To generate hTERT RPE-1 MLH1-/- cell lines, a sgRNA (Synthego, MLH1ex12: ATTTAACCATCTCCCCAGAG, 100 pmol) and Cas9 mRNA (TriLink, L-7206) were transfected into parental cell lines and inactivation was confirmed in clonal populations via Sanger sequencing (MLH1ex12_PCR_Forward ...
-
bioRxiv - Molecular Biology 2020Quote: ... each parental line was transfected with 1 µL of 100 µM sgRNA (Synthego Corporation) and 1 µg Cas9 mRNA (TriLink #L-7206) using the Neon Transfection System following standard protocols ...
-
bioRxiv - Immunology 2024Quote: ... was prepared in injection buffer by mixing 500 ng/μl of each of the sgRNAs (left and right) with Cas9 mRNA (1 μg/μl, TriLink, cat # L-6125). Fertilized eggs collected from B6/129 mice were microinjected at the CHOP transgenic core and transferred into pseudo-pregnant B6 females ...
-
bioRxiv - Cell Biology 2024Quote: ... 400 nM of each Alt-R™ guide RNA and 20 ng/µl plasmid DNA repair template (pR26 CAG LifeAct.mScarlet-I) were injected with 200 nM Alt-R™ SpCas9 protein and 30 ng/µl SpCas9 mRNA (TriLink, L-6125-20) in C57BL/6NRj zygotes as previously published.[17] CRISPR reagents were purchased from Integrated DNA Technologies (USA ...
-
bioRxiv - Neuroscience 2021Quote: ... which were then plated at 500,000 cells per well in a Matrigel-coated 6-well plate for transfection with 1.2 ug of Cre recombinase mRNA (TriLink Biotechnologies cat. no. L-7211) using Lipofectamine Stem to remove the puromycin resistance gene and mCherry ...
-
bioRxiv - Cell Biology 2021Quote: ... 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N [methoxy (polyethyleneglycol)-2000] (DMPE-PEG2000, NOF Corporation) and contained CleanCap® Enhanced Green Fluorescent Protein (eGFP) mRNA (5-methoxyuridine) (TriLink Biotechnologies, L-7201) and/or Clean Cap®Cyanine5 (Cy5 ...
-
bioRxiv - Immunology 2024Quote: ... Up to 5E6 cells were then resuspended in 100 μl Opti-MEM and electroporated with 10 μg CleanCap™ Cas9 mRNA (TriLink, Cat-no. L-7206). On day –5 ...