Labshake search
Citations for Bio-Synthesis :
1 - 5 of 5 citations for Triiodothyronine T3 ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 5’ Gppp- cap and 5’ m7Gppp- cap are synthesized by Bio-synthesis, Inc ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
bioRxiv - Molecular Biology 2019Quote: ... 500 nM substrate RNA (5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3, Bio-Synthesis, Inc.), and 60 nM yDcpS at 37 °C for 60 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... while the sense strand RNA with a 5′ triphosphate was synthesized by Bio-Synthesis (Texas, USA). The antisense strand with a 3′ phosphate was radiolabeled by T4 Polynucleotide Kinase (3’ phosphatase minus ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.2 µM the immobilized or solution form of SNAP-tagged FCE was incubated with 0.5 µM of a 5′ triphosphate 3′ FAM-labeled RNA oligonucleotide (ppp25-mer; Bio-synthesis Inc.) in reactions containing 50 mM Tris-HCl (pH 8.0) ...