Labshake search
Citations for Bio-Synthesis :
1 - 10 of 10 citations for Suppressor of CDC2 With RNA Binding Motif 2 RBMS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... A standard curve comprised of synthetic RNA containing the target sequence from SARS-CoV-2 isolate WA1 sequence (GenBank Accession Number MN985325.1) (Bio-Synthesis, Inc.; Lewisville, TX) was included on each PCR plate for absolute quantitation of SARS-CoV-2 copies in each sample ...
-
bioRxiv - Immunology 2021Quote: ... A standard curve comprised of synthetic RNA containing the target sequence from SARS-CoV-2 isolate WA1 sequence (GenBank Accession Number MN985325.1) (Bio-Synthesis, Inc.; Lewisville, TX) was included on each PCR plate for absolute quantitation of SARS-CoV-2 RNA copies in each sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µL of 100 µM caged AluGG crRNA (Bio-Synthesis)36 was mixed with 2 µL of 100 µM tracrRNA (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2021Quote: Total SARS-CoV-2 E gene and subgenomic E gene target copy numbers were determined by real-time RT-PCR using previously described assays (24–25) and a synthetic RNA containing the subgenomic E RNA sequence (Bio-Synthesis, Inc., Lewisville, TX, USA). Extracted nucleic acid was tested in triplicate (5 μL extracted nucleic acid ...
-
bioRxiv - Molecular Biology 2019Quote: ... 500 nM substrate RNA (5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3, Bio-Synthesis, Inc.), and 60 nM yDcpS at 37 °C for 60 minutes ...
-
bioRxiv - Systems Biology 2019Quote: ... 500 pmol of RNA oligo pppm6AGGCUCGAACUUAAUGAUGACG (Bio-Synthesis Inc.; Lewisville, TX USA) was heated at 65 °C for 5 min and then chilled on ice for 5 min ...
-
bioRxiv - Plant Biology 2021Quote: ... while the sense strand RNA with a 5′ triphosphate was synthesized by Bio-Synthesis (Texas, USA). The antisense strand with a 3′ phosphate was radiolabeled by T4 Polynucleotide Kinase (3’ phosphatase minus ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.25 μM recombinantly-produced ALPH enzyme and 3.8 μM capped RNA oligo m7G-AACUAACGCUAUUAUUAGAACAGUUUCUGUACUAUAUUG (Bio-Synthesis, Texas, USA). The sample was incubated for 1 hour at 37°C ...
-
bioRxiv - Systems Biology 2019Quote: ... RNA oligos (22 nt) with the following caps were synthesized by in vitro reaction of pppXGGCUCGAACUUAAUGAUGACG (Bio-Synthesis Inc. ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.2 µM the immobilized or solution form of SNAP-tagged FCE was incubated with 0.5 µM of a 5′ triphosphate 3′ FAM-labeled RNA oligonucleotide (ppp25-mer; Bio-synthesis Inc.) in reactions containing 50 mM Tris-HCl (pH 8.0) ...