Labshake search
Citations for Bio-Synthesis :
1 - 11 of 11 citations for 6 Quinoxalinecarboxylicacid 1 2 3 4 tetrahydro 2 oxo methyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µL of 100 µM caged AluGG crRNA (Bio-Synthesis)36 was mixed with 2 µL of 100 µM tracrRNA (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2021Quote: ... A standard curve comprised of synthetic RNA containing the target sequence from SARS-CoV-2 isolate WA1 sequence (GenBank Accession Number MN985325.1) (Bio-Synthesis, Inc.; Lewisville, TX) was included on each PCR plate for absolute quantitation of SARS-CoV-2 copies in each sample ...
-
bioRxiv - Immunology 2021Quote: ... A standard curve comprised of synthetic RNA containing the target sequence from SARS-CoV-2 isolate WA1 sequence (GenBank Accession Number MN985325.1) (Bio-Synthesis, Inc.; Lewisville, TX) was included on each PCR plate for absolute quantitation of SARS-CoV-2 RNA copies in each sample ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
bioRxiv - Molecular Biology 2019Quote: ... 500 nM substrate RNA (5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3, Bio-Synthesis, Inc.), and 60 nM yDcpS at 37 °C for 60 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.2 µM the immobilized or solution form of SNAP-tagged FCE was incubated with 0.5 µM of a 5′ triphosphate 3′ FAM-labeled RNA oligonucleotide (ppp25-mer; Bio-synthesis Inc.) in reactions containing 50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Biochemistry 2022Quote: ... composed of 5’ deoxynucleotides and 3’ ribonucleotides with or without a 3’ TEG-desthiobiotin group were designed as described in the main text and synthesized chemically (Integrated DNA Technologies or Bio-Synthesis, Inc). For the investigation of RNase H cleavage specificity ...
-
bioRxiv - Cell Biology 2020Quote: ... (sequence: [Atto 655] CMGVADLIKKFESISKEE[COOH] (Bio-Synthesis, Lot No. P5869-1)) ...
-
bioRxiv - Biochemistry 2019Quote: ... Human LRAT peptide (AA 1-39) was synthesized by Bio-Synthesis (Lewisville, Texas, USA).
-
bioRxiv - Biophysics 2022Quote: ... The peptides [RGRGG]1,2,3,4,6,8,10 and Cy5-labeled [RGRGG]1 were obtained from Bio-Synthesis, Inc ...
-
bioRxiv - Immunology 2019Quote: ... or with 1 µg/ml of synthetic 17-mer HIV-MPER peptide (GNEQELLELDKWASLWN, Bio-Synthesis Inc.) for antigen-specific ELISA ...